ID: 922791914

View in Genome Browser
Species Human (GRCh38)
Location 1:228315625-228315647
Sequence GCCCAGTGCCAAAGTGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922791908_922791914 8 Left 922791908 1:228315594-228315616 CCTGTGAGGTTTCTCACCTGTGA 0: 1
1: 0
2: 0
3: 19
4: 178
Right 922791914 1:228315625-228315647 GCCCAGTGCCAAAGTGGGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 238
922791910_922791914 -8 Left 922791910 1:228315610-228315632 CCTGTGAGGTCAGAAGCCCAGTG 0: 1
1: 1
2: 3
3: 37
4: 261
Right 922791914 1:228315625-228315647 GCCCAGTGCCAAAGTGGGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922791914 Original CRISPR GCCCAGTGCCAAAGTGGGCA GGG Intronic
900365138 1:2308932-2308954 TCCCAGAGCCGAAGTGGGGAAGG - Exonic
901120678 1:6890538-6890560 TCCAAGAGCCTAAGTGGGCAAGG - Intronic
901193405 1:7425890-7425912 GCCCAGTGGCTATGGGGGCAGGG - Intronic
902186344 1:14728437-14728459 GCCCAGTTCCTAAGAGGCCATGG + Intronic
902821369 1:18945328-18945350 GCCTATTGCCACAGTGGGCCAGG + Intronic
902854307 1:19189179-19189201 GCCCATTGTCAAAGAGAGCATGG + Intronic
903117837 1:21192708-21192730 GGGCAGTGCCAGAGTGGGGAGGG - Intergenic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
903767221 1:25742564-25742586 GCCCAGTGCCAGTAGGGGCAAGG + Intronic
904213133 1:28898736-28898758 GCCCAAGGCCAAGGCGGGCAAGG - Intronic
904272362 1:29358437-29358459 AACCAGTGCCAAAGGGGGCCAGG - Intergenic
905391802 1:37640675-37640697 TCCCAGTGCCAAGGTGGGATTGG - Intergenic
907485818 1:54777400-54777422 GCCCAGTGGAGAAGAGGGCATGG - Intergenic
907597465 1:55732966-55732988 GCCCATTAACAAAGTGGCCATGG + Intergenic
911996094 1:104768797-104768819 GCACTTTGCCAAAGAGGGCATGG + Intergenic
912174305 1:107139119-107139141 GCCCAGGGCCAAGGAGGGCCTGG + Intergenic
913229478 1:116729865-116729887 GCCCAGTGCCAATGAGGGGCTGG + Intergenic
915106188 1:153536357-153536379 GCGCAGCGTCAATGTGGGCAAGG + Intergenic
915709777 1:157884488-157884510 GCCCATTAACAAAGTGGCCATGG + Intronic
918555636 1:185796317-185796339 GCCCAGTTCCTAAGAGGCCACGG + Intronic
919661720 1:200254231-200254253 GCCCAGAGCCACAGAGGGAAGGG + Intergenic
920013833 1:202889349-202889371 GCCCAGTGGCCAGGTGGGTATGG - Intergenic
921165522 1:212504111-212504133 GCCCAGAGCCAGTGTGGGCAGGG - Intergenic
921193033 1:212726554-212726576 GCCCAGAGACAAGGTGGACAGGG - Intronic
921632923 1:217456222-217456244 TCCCAAAGCCCAAGTGGGCATGG - Intronic
922176969 1:223204560-223204582 GGCAAGTGCCCATGTGGGCAAGG - Intergenic
922213310 1:223501495-223501517 GTTCAGTGCCAAAGTAGGGAAGG + Intergenic
922791914 1:228315625-228315647 GCCCAGTGCCAAAGTGGGCAGGG + Intronic
924840658 1:247706984-247707006 GCCCATGGACAAAGTGGCCATGG - Intergenic
1063666146 10:8061895-8061917 GCCCAGTGCCCAAGTAGGGGAGG + Intronic
1063812849 10:9733971-9733993 GCACAGTTCCAAAGTAGGCAAGG - Intergenic
1064772561 10:18738493-18738515 TCCCAGGGACAAAGTGGTCATGG + Intergenic
1065689749 10:28320987-28321009 GCGCATTGTCAGAGTGGGCATGG - Intronic
1065913007 10:30326521-30326543 AGCCAGGGCCAAAGTGGTCAAGG + Exonic
1066457980 10:35588048-35588070 GCCCAGAGCCAGGGTGGGCCTGG - Intergenic
1067709203 10:48635220-48635242 GCCCAGTGCAGAAGTGGGGGTGG - Intronic
1069807452 10:71134787-71134809 GGCCACTGCCAAATTGAGCAGGG + Intergenic
1071038174 10:81273248-81273270 ACTTGGTGCCAAAGTGGGCAGGG - Intergenic
1073341308 10:102746663-102746685 GCCCTGTGCCAAAATGGCCTTGG - Intronic
1074415353 10:113262661-113262683 GCCCACTGGCAGAGTGGCCAAGG - Intergenic
1076494241 10:130886373-130886395 GCCCCGTAGAAAAGTGGGCACGG - Intergenic
1076701421 10:132275202-132275224 GCCCAGAGACATGGTGGGCACGG - Intronic
1076708887 10:132320273-132320295 GCCCATTGCCAGAGTGGTGAGGG + Intronic
1076885154 10:133258797-133258819 CCTCAGTGCCACAGTGGGCTGGG - Intergenic
1077216060 11:1395599-1395621 GCCCAGGGCCACAGTGGGTGGGG - Intronic
1077546789 11:3175276-3175298 ACCCAGTGCCACAGTGTGCCAGG - Intergenic
1077614700 11:3666449-3666471 GCCCAGTGCCAGCCTGGGCTAGG - Exonic
1081597780 11:44471106-44471128 GCCCCGTGCCCCAGTGAGCATGG + Intergenic
1083091947 11:60208918-60208940 TCCCAGTGCTATTGTGGGCATGG + Intronic
1083100982 11:60305854-60305876 TCCCAGTGCTATTGTGGGCATGG - Intronic
1083134106 11:60655339-60655361 GCCCATTAACAAAGTGGCCATGG + Intergenic
1083353488 11:62047883-62047905 GCTGGGGGCCAAAGTGGGCAAGG - Intergenic
1083904124 11:65659155-65659177 GCTCATTGCCAAGGTGGGTATGG - Intronic
1084539655 11:69777871-69777893 GCACAGTGGCAGATTGGGCAGGG - Intergenic
1085566589 11:77520035-77520057 CCCCAGTGCACATGTGGGCATGG + Intronic
1087911865 11:103762968-103762990 GCCCAGTCCCAGAGTAGACAAGG - Intergenic
1088407500 11:109497843-109497865 GCCCATTAACAAAGTGGCCATGG - Intergenic
1089680485 11:120116534-120116556 GCTCAGTGCCAACCTGGGAAGGG - Intronic
1090736597 11:129616655-129616677 GCCAAGAGCTAGAGTGGGCAGGG + Intergenic
1091115586 11:133009833-133009855 GCCCAGTTCCTAACAGGGCATGG + Intronic
1094045528 12:26161941-26161963 GCCCAGTTCCTAACTGGCCATGG + Intronic
1099686045 12:85890843-85890865 TGCCAGTGCCTACGTGGGCAAGG - Intergenic
1100415711 12:94371724-94371746 TCCTAGAGCCAAAGAGGGCAAGG + Intronic
1104460677 12:128953152-128953174 ACACAGTGAAAAAGTGGGCAAGG - Intronic
1104763528 12:131312438-131312460 GCCCAGCACCACGGTGGGCACGG + Intergenic
1104815974 12:131645639-131645661 GCCCAGCACCACGGTGGGCACGG - Intergenic
1105331557 13:19421365-19421387 GCCCTGAGCCATGGTGGGCACGG - Intergenic
1105880227 13:24599185-24599207 GCCCTGAGCCATGGTGGGCACGG + Intergenic
1105919605 13:24949681-24949703 GCCCTGAGCCATGGTGGGCACGG - Intergenic
1107485254 13:40820522-40820544 GCCCCGAGCCATGGTGGGCATGG - Intergenic
1108441327 13:50456267-50456289 GCCAAGAGCCACAGTGGACAAGG - Intronic
1109328494 13:60899534-60899556 CCCCAGTGCAAAAGTGGTGATGG + Intergenic
1110080044 13:71298179-71298201 GCCCAGTGTCAATGTGGGATAGG + Intergenic
1110404446 13:75134125-75134147 GCCCAAACCCAAAGTGGGCAAGG + Intergenic
1113890043 13:113730940-113730962 GCCCAGCACTAGAGTGGGCATGG + Intronic
1116436267 14:44897770-44897792 GCCCAGGGCCAGGGTGGGCGTGG + Intronic
1116932726 14:50705643-50705665 GCCCAGTGCCAAGGAGGCCGGGG + Intergenic
1121096183 14:91219669-91219691 GCCAAGGGCCAGAGTGGGCAGGG - Intronic
1122317602 14:100835230-100835252 TCTCAGGACCAAAGTGGGCACGG + Intergenic
1122609191 14:102969655-102969677 CCACAGTGGCCAAGTGGGCAAGG - Intronic
1122642748 14:103170112-103170134 GCTCTGTGCCAAAGTGTGGAAGG + Intergenic
1123876365 15:24627698-24627720 GCCAAGTGCCAACGTGGGCCTGG - Intergenic
1124803061 15:32853819-32853841 GGCCAGGCCCAGAGTGGGCAGGG + Intronic
1127077072 15:55337363-55337385 GCCCAGTTCCTAAGAGGCCATGG - Intronic
1127550852 15:60036992-60037014 GCCCAGTTCCTAAGAGGCCATGG + Intronic
1128262322 15:66241099-66241121 GCCCAGATCCCAAGAGGGCAGGG - Intronic
1128268708 15:66290335-66290357 GCCCAGAGAAAAAGAGGGCATGG + Intergenic
1129161628 15:73751242-73751264 GCCCAGGGCCAGGGTGGGCTGGG - Exonic
1131565690 15:93483436-93483458 GCCCAGTTCCAAACAGGCCACGG - Intergenic
1132710391 16:1263710-1263732 GGCCAGTGCCACAGAGGCCAAGG + Intergenic
1133225646 16:4339090-4339112 GCCCAGTGGCAAGGTGGGCCGGG - Exonic
1135933098 16:26756283-26756305 GCTCAGTGCCAAGGTGGGAGGGG - Intergenic
1136086387 16:27888197-27888219 GCCCGGGGCCCACGTGGGCAGGG - Intronic
1136991051 16:35151623-35151645 GCCCAGTTAAAAAGTGGACAAGG - Intergenic
1140092757 16:71851222-71851244 GCGCAGTGCCGAAGTGAGCGGGG + Exonic
1141609758 16:85174729-85174751 ACCCAGTGCCAGGGTGGGCATGG + Intronic
1142597698 17:1037579-1037601 ACCCAGGGACAGAGTGGGCAGGG + Intronic
1144468324 17:15515097-15515119 GCCCATACCCACAGTGGGCATGG + Intronic
1144909332 17:18668068-18668090 GCCCGGTTCTGAAGTGGGCAGGG - Intronic
1145239058 17:21228980-21229002 GCCCAGGGCCAGAGAGAGCAGGG + Intergenic
1146889364 17:36496078-36496100 GCCCAGTGCGTCAGTGGGCCTGG - Exonic
1146913166 17:36660932-36660954 ACCCAGTGCCACACTTGGCAGGG + Intergenic
1148839885 17:50488211-50488233 GTCCTGTGACAAAGTGGGAAGGG + Intergenic
1149302836 17:55320588-55320610 GCCCAGTGCCAGCCAGGGCACGG - Intronic
1150157503 17:62866419-62866441 GTAAAGTGCCCAAGTGGGCAGGG + Intergenic
1150282742 17:63938788-63938810 GCCCAGGGCCCAGGAGGGCAAGG + Exonic
1152014994 17:77744696-77744718 GGCCAGGACCATAGTGGGCAGGG - Intergenic
1152040706 17:77900839-77900861 GCACAGAGCCAGTGTGGGCATGG - Intergenic
1152565965 17:81100596-81100618 GCCCAGTGGCACAGTGGTCTTGG - Intronic
1153522677 18:5967219-5967241 GCCCAGGGCCACAATGAGCATGG + Intronic
1156786296 18:40919490-40919512 GCTCAGTGCAAAAGGGGACAAGG - Intergenic
1159222375 18:65481516-65481538 GCCCAGTTCCAAACAGGCCACGG + Intergenic
1159960974 18:74555537-74555559 GTCCTGTGGCAAAGTGGGCAAGG - Intronic
1160521477 18:79510763-79510785 GCCCAGGGCCACACAGGGCAGGG - Intronic
1160899718 19:1421653-1421675 GCCCAGTGCCAGAGGGAGCTGGG + Intronic
1161375282 19:3936747-3936769 GCCCAGTGCCCGTGTGGGCTGGG + Intronic
1162476764 19:10905119-10905141 GCCCAGAGCCCTGGTGGGCAGGG + Intronic
1162798980 19:13100863-13100885 GTGCAGGGCCAAAGTGGGCGGGG + Exonic
1163835978 19:19574406-19574428 GCCAAGGGCCACAGTGGCCACGG - Intronic
1165072655 19:33264523-33264545 GCCGAGTGCCATAGGAGGCATGG - Intergenic
1165099131 19:33428194-33428216 GCACAGTGCCAAGGAGGGCTTGG + Intronic
1165741766 19:38209213-38209235 GGCCAGGGCCAAAGGAGGCAGGG - Intergenic
925499299 2:4486111-4486133 GCCCATTAACAAAGTGGCCATGG - Intergenic
928045280 2:27924996-27925018 GCCAAGAGCCAAAGTGCTCAAGG - Intronic
928921083 2:36528801-36528823 GACCAGTTCCAAAGTTAGCATGG - Intronic
929453497 2:42051287-42051309 GCCCAGGGCCAAAGGGCACAAGG + Intronic
932418739 2:71588964-71588986 GCCCAGTGCTAATGAGGGCGAGG + Intronic
932870588 2:75394265-75394287 GCCCATGACCAAAGTGGCCATGG - Intergenic
933443754 2:82350174-82350196 TCCCAAAGCCGAAGTGGGCATGG - Intergenic
934711316 2:96516163-96516185 GCCCAGTGAGAAACTGGACATGG + Intergenic
935729724 2:106055426-106055448 GAGCAGTGCCACAGTGGGGATGG + Intergenic
936527576 2:113252090-113252112 GCCCAGTCCTAAAGTGGCAATGG + Intronic
937087067 2:119178636-119178658 CCCCAGAGCCAAAGTAGGGAGGG - Intergenic
937363246 2:121243449-121243471 GCCCAGTTCCTAACAGGGCATGG - Intronic
938099242 2:128486840-128486862 GCCCCGTGGCAGAGTAGGCATGG - Intergenic
939570982 2:143839407-143839429 GACCAGTTCCAGAGTGGTCAGGG + Intergenic
940849924 2:158678447-158678469 CCCCAGTGCCAATGCGGGCTGGG - Intronic
942569847 2:177302791-177302813 GCCCATTGACAGAGTTGGCATGG - Intronic
943156641 2:184187759-184187781 GCCCAGTTCCAAACAGGCCATGG + Intergenic
943383958 2:187180272-187180294 GCCCATGAACAAAGTGGGCATGG - Intergenic
944010371 2:194967094-194967116 GCCCAGTGACAATTTGTGCAGGG + Intergenic
944505030 2:200402307-200402329 GCACAAAGCAAAAGTGGGCAAGG - Intronic
945642291 2:212444656-212444678 GCCCAGGAACAAAGTGGCCACGG + Intronic
948040916 2:234900840-234900862 GCCCAGGGCGAGGGTGGGCAGGG - Intergenic
1170418652 20:16170815-16170837 GCCCAGTGTCAATGTGGGAGGGG + Intergenic
1170611185 20:17915013-17915035 GCCCAAGGGCAATGTGGGCAGGG - Intergenic
1172096590 20:32463490-32463512 GCCCTTTGCCACAGTGGGGAGGG - Intronic
1173901427 20:46592568-46592590 TCCCACTCCCAAAATGGGCATGG - Intronic
1175738572 20:61404573-61404595 GCACAGAGACAACGTGGGCAGGG + Intronic
1176741443 21:10607225-10607247 GCCCTGAGCCATGGTGGGCACGG + Intergenic
1177138960 21:17338026-17338048 CCCCAGTGATCAAGTGGGCAAGG - Intergenic
1178327422 21:31657204-31657226 GCCCAGTGCCACAAGGAGCAGGG - Intergenic
1178604922 21:34027804-34027826 GCCCAGTTCCTAAGAGGCCATGG - Intergenic
1179620997 21:42616312-42616334 GACCAGTGCAAAGTTGGGCATGG - Intergenic
1181010323 22:20036562-20036584 GGCCAGTGCCAATGAGTGCATGG + Intronic
1181057921 22:20268526-20268548 GCCCGGTCCCCAAGCGGGCAAGG + Exonic
1181461946 22:23090776-23090798 GCCCAGTGCTACAGTGGAAATGG - Intronic
1181685501 22:24525143-24525165 GCCCATTACCAAAGTTGGGAAGG - Intronic
1181949571 22:26544325-26544347 GCTGAGTCCCAAAGTGGGCGGGG - Intronic
1183081281 22:35458302-35458324 GCCAAGTGCCCACGTGAGCAGGG - Intergenic
1183081427 22:35459052-35459074 GCCAAGTGCCCACGTGAGCAGGG - Intergenic
1185370762 22:50459877-50459899 GCCCAGGCCCACAGCGGGCAGGG + Intronic
952897235 3:38085744-38085766 GACCTGTGCCACAGTGGGCAAGG + Intronic
953197824 3:40750619-40750641 TGACAGTCCCAAAGTGGGCAGGG + Intergenic
953422879 3:42768835-42768857 CCCCAGTTAAAAAGTGGGCAAGG + Intronic
953814973 3:46147721-46147743 GCCCAGTTCCTAACAGGGCATGG + Intergenic
954055270 3:48018148-48018170 GCCCAGTTCCTAACTGGCCATGG + Intronic
954197418 3:49004948-49004970 GCCCACTGTCCACGTGGGCATGG - Exonic
954367997 3:50156236-50156258 TCCCAGTGGTGAAGTGGGCAGGG + Intronic
954385488 3:50241801-50241823 GCCCAGGGCCAAAGGGGTCCCGG - Intronic
954671686 3:52294417-52294439 GCCCAGAGCCCAGGTGGGGAAGG - Intergenic
954731390 3:52665519-52665541 GCCCAGTTCCAAACAGGCCATGG - Intronic
961491682 3:127260908-127260930 GCACAGTGGCACAGGGGGCAGGG + Intergenic
961616778 3:128188801-128188823 GCCCTGTGCCTGAGGGGGCATGG + Intronic
962375277 3:134853807-134853829 GCCCAGGGCCAAAGCAGGGATGG + Intronic
967131614 3:186476143-186476165 GTCCACTGCCACAGTGAGCAGGG - Intergenic
967369972 3:188732985-188733007 GCCCATTGCCAAAGTGGTACTGG - Intronic
968289464 3:197527447-197527469 GCCCAGTGCCCTGGTGGGCTGGG - Intronic
968541170 4:1169166-1169188 GCACTGGGCCACAGTGGGCAGGG - Intronic
968866044 4:3212585-3212607 GGCCCGGGCCAGAGTGGGCAGGG - Exonic
968885082 4:3324598-3324620 GGCCCTTGACAAAGTGGGCAAGG + Intronic
969541067 4:7789142-7789164 GCCCAGTCCCCAAGAGGGCAGGG + Intronic
969542703 4:7803561-7803583 ACCCAGTCCCCAAGAGGGCATGG + Intronic
969847052 4:9927516-9927538 GCTCAGTGCCACTCTGGGCATGG - Intronic
970274973 4:14389042-14389064 CCCCAGTGCCCAAGTGAGAAAGG + Intergenic
971259042 4:25039696-25039718 GCTGAGTGCAAAAGGGGGCATGG + Intergenic
971280517 4:25239404-25239426 GCCCAGTGAGAAAGCGAGCACGG + Intronic
972240738 4:37189086-37189108 GCCCAGGAACAAAGTGGCCACGG + Intergenic
973054594 4:45640401-45640423 GCTCTGTGCCAAAGTGTGGAAGG + Intergenic
975612805 4:76218145-76218167 GACCTGTCCCAAAGTAGGCAAGG - Intronic
979544269 4:121921725-121921747 CCTCTGTGCCAGAGTGGGCAGGG + Intronic
986659182 5:10043774-10043796 GCCCTGCGGCCAAGTGGGCATGG - Intergenic
992427669 5:76674776-76674798 GCCCAGAGCTAGAGTGGGCATGG + Intronic
995233803 5:109801640-109801662 TCCCTGAGCCGAAGTGGGCAAGG - Intronic
997978529 5:138454432-138454454 GCCCAGAGCCAGTGTGGGGAGGG + Intergenic
999326207 5:150645268-150645290 GGCCAGTGCTAATGAGGGCAAGG + Intronic
1000617151 5:163439180-163439202 GCCCAGTGCAAAGATGGCCAAGG + Intronic
1002559654 5:180072521-180072543 CCCCAGTGCCAAAATGGTTAGGG - Intergenic
1002567391 5:180119620-180119642 GCCCAATGCCATAGAGGGCTAGG + Intronic
1006188637 6:32194563-32194585 GCCCAGTTCCTAAGAGGCCATGG + Intronic
1007615286 6:43176212-43176234 GCCCTGTGGCAATGAGGGCACGG - Intronic
1007770858 6:44191382-44191404 GTCCAGTACAAAAATGGGCAAGG - Intergenic
1011626911 6:89290520-89290542 GCCCAGTGCCCAAGTGTGGCCGG + Intronic
1013586210 6:111581263-111581285 GCCCAGGCCCAAAGGGGGTAAGG + Intronic
1015041836 6:128730036-128730058 TCACACTGACAAAGTGGGCAAGG - Intergenic
1015465362 6:133542903-133542925 GGGCAGTGGCAATGTGGGCAGGG + Intergenic
1015515859 6:134082000-134082022 GACCATTGCCAAAGGGGTCAGGG - Intergenic
1015853836 6:137602903-137602925 GCCCAGGGCCAAAGACTGCATGG - Intergenic
1015897687 6:138033186-138033208 GACCAATGCCACAGTGGACAAGG - Intergenic
1015988635 6:138912043-138912065 GCCCAGTCCCCTAATGGGCACGG + Intronic
1018255153 6:161911215-161911237 GCCCAGTGCCAAAGAGGAAGTGG + Intronic
1018465002 6:164035823-164035845 TCCCAGAGCCACAGTGGTCAGGG + Intergenic
1019576892 7:1741885-1741907 GCCCAGGGCCCCAGTGAGCATGG + Intronic
1019612405 7:1943452-1943474 ACCCAGTGTCACAATGGGCAAGG + Intronic
1022520035 7:31000356-31000378 GGCCAGGGCTAATGTGGGCAGGG + Intergenic
1022590336 7:31655253-31655275 GCTCAGTGCCACAGTGTGCATGG + Intronic
1023729137 7:43173722-43173744 GCCCAGTTCCAAACAGGCCAAGG + Intronic
1023830948 7:44038797-44038819 GCCCAGCTCCAAGGTGGGTAAGG - Intergenic
1025780459 7:64597041-64597063 GCCCAGAGACAAAGAGGCCAAGG - Intergenic
1026977758 7:74508771-74508793 TCCCAGGGACAAAGTGGGAATGG - Intronic
1029741282 7:102493106-102493128 GCCCAGCTCCAAGGTGGGTAAGG - Exonic
1029759272 7:102592275-102592297 GCCCAGCTCCAAGGTGGGTAAGG - Exonic
1029775060 7:102680353-102680375 GCCCCGGGGCAAGGTGGGCAGGG - Intergenic
1029776641 7:102688185-102688207 GCCCAGCTCCAAGGTGGGTAAGG - Intergenic
1030021848 7:105282960-105282982 ACCCAATGATAAAGTGGGCAAGG + Intronic
1031497228 7:122465425-122465447 GCCCAGTTCCAAACAGGCCATGG - Intronic
1033047856 7:137978791-137978813 GCCCAGTGCTGCAGTGGGCTAGG - Intronic
1034331078 7:150282683-150282705 TCCTAGTGACAAAGTGGTCAGGG + Intronic
1034474282 7:151273838-151273860 GCCCAGGGCAAAATGGGGCAGGG - Intronic
1034666965 7:152827170-152827192 TCCTAGTGACAAAGTGGTCAGGG - Intronic
1036652731 8:10655413-10655435 GCCCAGTACCACGGTGGGCGGGG - Intronic
1039070727 8:33647248-33647270 GCCCAGTTCCTAACTGGCCATGG + Intergenic
1041351186 8:56949494-56949516 GCCCAGTGCCTAATGGGCCATGG - Intergenic
1042532837 8:69832881-69832903 GCCGCGTGCCACAGGGGGCAGGG + Exonic
1047295783 8:123569486-123569508 ACCCAGTGCAGAAGTGAGCAAGG - Intergenic
1049012075 8:139893929-139893951 GCCCCGTGCCCCTGTGGGCAGGG - Intronic
1049171901 8:141166807-141166829 GGCCAGGGCTAAAGTGAGCAGGG + Intronic
1049289188 8:141792458-141792480 CCCCAGGGCCACAGTGGGCCGGG + Intergenic
1049842055 8:144779001-144779023 GCTCTGTGCCAAAGGGGGGAAGG + Intronic
1052227693 9:26109190-26109212 GCCCAGGAACAAAGTGGCCATGG + Intronic
1052335393 9:27314324-27314346 GCCCAGTGCCAAAAGGGTGAAGG + Intergenic
1057336016 9:94155905-94155927 GCCCAGCACCAAGCTGGGCACGG - Intergenic
1058124689 9:101178196-101178218 GCCCATGGACAAAGTGGCCATGG + Intronic
1058545492 9:106056661-106056683 GCCCATTATCAAAGTGAGCAGGG - Intergenic
1061099216 9:128479323-128479345 GCCCAGTGAGAAAATGGGCCAGG + Intronic
1187533793 X:20119123-20119145 GCCCAGTGGAAAGGTGGGCAAGG - Intergenic
1188704618 X:33311792-33311814 GCCAAGTGCCAAATGGTGCAGGG + Intronic
1191664090 X:63680600-63680622 GCCCTGTGCCAAAGAGGCCACGG - Intronic
1194834058 X:98659616-98659638 GCCCAGGAACAAAGTGGCCATGG + Intergenic
1195927256 X:110038412-110038434 TCCCTGAGCCAAAGTGGGCATGG - Intronic
1198117629 X:133559403-133559425 GCCAGGTGCCATAGTGGGTACGG + Intronic
1198692653 X:139301097-139301119 GCACAGTGCCATGGGGGGCAAGG - Intergenic
1200359980 X:155594293-155594315 TCAAAGTGCCAAAGTGGGGAGGG + Intronic
1201304237 Y:12537049-12537071 CCCCTGTGCCAAATTGTGCATGG - Intergenic