ID: 922792409

View in Genome Browser
Species Human (GRCh38)
Location 1:228317613-228317635
Sequence CTGTGCCACGAGCTGGTGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922792401_922792409 17 Left 922792401 1:228317573-228317595 CCGCGTGGAGGTGAAGGAGGGGG 0: 1
1: 0
2: 4
3: 39
4: 390
Right 922792409 1:228317613-228317635 CTGTGCCACGAGCTGGTGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 186
922792406_922792409 -6 Left 922792406 1:228317596-228317618 CCACAGGCCAGTGGCGGCTGTGC 0: 1
1: 0
2: 3
3: 19
4: 203
Right 922792409 1:228317613-228317635 CTGTGCCACGAGCTGGTGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922792409 Original CRISPR CTGTGCCACGAGCTGGTGCC TGG Exonic
900294790 1:1943446-1943468 CTGTGCCTGGGGCCGGTGCCCGG + Intronic
900604107 1:3516220-3516242 CTGTGCCCTGAGCTGGCGCAGGG + Intronic
901929523 1:12588096-12588118 CTGTGTCCCTACCTGGTGCCCGG + Intronic
902330977 1:15731138-15731160 CTGTCCCAGGAACTGGGGCCAGG - Intronic
902619824 1:17644360-17644382 CTGTCCCACAGGCTGGTGCTGGG + Intronic
902631167 1:17705533-17705555 CTGGGCCATGAGCTGGGGCTGGG + Intergenic
903479016 1:23639630-23639652 CTGAGCAAGGAGCTGGTGCCAGG - Intronic
904351078 1:29907125-29907147 CTGGGCCACCACCTCGTGCCTGG + Intergenic
904463720 1:30695569-30695591 CTCTGCCGTGGGCTGGTGCCAGG + Intergenic
906962606 1:50427496-50427518 CTATGCCACGACCTGGGACCGGG + Intergenic
907138237 1:52159199-52159221 TTGGGCCACCAGCTTGTGCCAGG + Intronic
907307335 1:53520633-53520655 CTGGGCCAGGAGCTGCTCCCAGG - Exonic
907456838 1:54581612-54581634 CTGTGCCAAGTGCTGGCCCCAGG - Intronic
910552043 1:88486320-88486342 CTGTGTCAAGACCTGGTACCAGG - Intergenic
911090093 1:94011159-94011181 CTGTGGCAGGGGCTGGTGCTAGG - Intronic
918074426 1:181159633-181159655 CTGTGTGATGAGTTGGTGCCAGG + Intergenic
920038659 1:203082126-203082148 CTGAGCCCGGAGCTGGTGCAGGG + Intergenic
920378410 1:205521899-205521921 CTGTGCCTGGTGCTGGTGCATGG + Intronic
922792409 1:228317613-228317635 CTGTGCCACGAGCTGGTGCCTGG + Exonic
1063753214 10:8975956-8975978 CTGTGACTCCAGCTTGTGCCTGG + Intergenic
1064127529 10:12676365-12676387 GTGTGTCACGAGGTGGTGGCGGG - Intronic
1064268430 10:13843821-13843843 TTGTGCAAGGAGGTGGTGCCTGG + Intronic
1064559336 10:16580665-16580687 CAGTGTGACGAGTTGGTGCCTGG + Intergenic
1065593910 10:27294062-27294084 GTGAGCCTAGAGCTGGTGCCTGG - Intergenic
1067492662 10:46726457-46726479 CTGGGCCACAAACTGGTACCGGG + Intergenic
1067602004 10:47613938-47613960 CTGGGCCACAAACTGGTACCGGG - Intergenic
1067964414 10:50893262-50893284 CTGTACCCCAAGCTGGTTCCTGG - Intergenic
1067979861 10:51073541-51073563 CTCCGCCTTGAGCTGGTGCCTGG - Intronic
1070480235 10:76875178-76875200 CTTTGGCAAAAGCTGGTGCCTGG - Intronic
1072524911 10:96263218-96263240 CTGTGCTCGGAGCTTGTGCCTGG - Intronic
1072610840 10:97016957-97016979 CTGTGGTACGAGCTGGGGCAGGG + Intronic
1075841897 10:125511908-125511930 CTGTGCAGCCAGCTGGTTCCGGG - Intergenic
1075925432 10:126248052-126248074 CTGTGCCACCAGCAGGTGCAGGG - Intronic
1076900680 10:133336064-133336086 CAGTCACACGCGCTGGTGCCCGG - Intronic
1076945830 10:133649076-133649098 CTGCGCCTCGCGCTGGAGCCTGG + Intergenic
1077013972 11:391946-391968 CTGTGTCAGGAGCTGGCTCCAGG + Intergenic
1077128034 11:952920-952942 CAGTGGCACGAATTGGTGCCTGG + Intronic
1077522281 11:3043465-3043487 CTCTGACCCCAGCTGGTGCCTGG + Intronic
1078547530 11:12256922-12256944 CTGTGCCACCACCTTGCGCCTGG + Exonic
1083160178 11:60849756-60849778 CTGTGCCACGGTCTAGTGCCAGG - Intronic
1083200668 11:61119240-61119262 CTGTGCCACCAGCTGCAGCCTGG - Exonic
1083960587 11:66012814-66012836 CTATGCCCCCAGCTGGTGGCCGG + Exonic
1084474077 11:69378843-69378865 CTGTGCCACCAGCTCTTGCAGGG - Intergenic
1088200166 11:107323635-107323657 CTGTGCCACTATCTGGGCCCAGG + Intergenic
1090922983 11:131223430-131223452 CTGAGCAAGGATCTGGTGCCTGG - Intergenic
1091564769 12:1640034-1640056 CTGTGCCACCAGCCGTGGCCTGG + Intronic
1091727718 12:2857247-2857269 CTGTAACAGGAGCTGCTGCCGGG + Intronic
1092029877 12:5275276-5275298 CTGTGCCACAGGCTGGAGCAGGG - Intergenic
1095089311 12:38088899-38088921 ATGTGACAAGGGCTGGTGCCCGG - Intergenic
1096411318 12:51378992-51379014 CCGTGCCAGGTCCTGGTGCCAGG + Intronic
1096672987 12:53211171-53211193 CTGTGCCCCGTCCTTGTGCCAGG - Exonic
1096775642 12:53961830-53961852 CTGTGCCGCCCGCTGGAGCCTGG + Intergenic
1097781248 12:63707551-63707573 CTGTGCCAAGGGCTGCTGACAGG + Intergenic
1099497031 12:83361457-83361479 TGGTGCTATGAGCTGGTGCCAGG + Intergenic
1100089793 12:90955077-90955099 CTGAGGCACGGGCTGGGGCCGGG + Exonic
1101294469 12:103406934-103406956 CTCTGCTATGAGCTGCTGCCAGG + Intronic
1102951546 12:117034781-117034803 CTGTGCCTCGGGCTGGAGGCAGG - Intergenic
1103459128 12:121089878-121089900 CTGTGACAGGAGCTGGGGACGGG - Intergenic
1104038485 12:125114645-125114667 ATGTGCCACGGGCCGGCGCCTGG - Intronic
1104038517 12:125114756-125114778 ATGTGCCACGGGCCGGCGCCTGG - Intronic
1104038528 12:125114792-125114814 ATGTGCCACGGGCCGGCGCCTGG - Intronic
1104038541 12:125114828-125114850 ATGTGCCACGGGCCGGCGCCCGG - Intronic
1104038554 12:125114864-125114886 ATGTGCCACGGGCCGGCGCCCGG - Intronic
1104845763 12:131845999-131846021 CACTGCCACGAGGTGGTTCCTGG - Intronic
1106240427 13:27907867-27907889 CTGTGCCAGGCACTGTTGCCAGG - Intergenic
1106584065 13:31042215-31042237 GGGTGCCACTGGCTGGTGCCAGG - Intergenic
1111664488 13:91249847-91249869 CTGTGCCAGGGGCTGGTGCTGGG - Intergenic
1125854764 15:42938314-42938336 CTGTGCCCTGAGCTGCAGCCAGG - Intergenic
1127850397 15:62907135-62907157 CTGTGGTAGGAGCTGGTGCCTGG - Intergenic
1128653128 15:69434901-69434923 CTGCACCACGAGCTGGAGCTGGG - Intronic
1128775689 15:70318419-70318441 CAGTGCAACCAGCTGGTTCCTGG - Intergenic
1132816126 16:1827431-1827453 CTGCACCACGAGCTGGAGCTGGG + Exonic
1134098618 16:11436062-11436084 CTGGGCCAGGAGCTGGAGCCAGG - Intronic
1136716539 16:32287405-32287427 CTGTCCCACAAGGAGGTGCCCGG + Intergenic
1136782470 16:32915634-32915656 AGGTCCCAGGAGCTGGTGCCGGG + Intergenic
1136834927 16:33493683-33493705 CTGTCCCACAAGGAGGTGCCCGG + Intergenic
1136887322 16:33938217-33938239 AGGTCCCAGGAGCTGGTGCCGGG - Intergenic
1137505635 16:49051735-49051757 GTGTGCCAGGAGCAGCTGCCAGG + Intergenic
1137802426 16:51273497-51273519 CTGAGACAAGAGCTGGTGCAGGG - Intergenic
1141148416 16:81547838-81547860 CTGGGGCACAAGCTGGTCCCAGG - Intronic
1141733154 16:85835585-85835607 CTGTCCCACCAGGTCGTGCCTGG + Intergenic
1142045982 16:87925573-87925595 CAGTGACACCAGCTGGTGCTGGG + Intronic
1142149123 16:88504986-88505008 CTCTGCCATTAGCTGGGGCCAGG + Intronic
1203009876 16_KI270728v1_random:230349-230371 CTGTCCCACAAGGAGGTGCCCGG - Intergenic
1203085130 16_KI270728v1_random:1179621-1179643 AGGTCCCAGGAGCTGGTGCCGGG + Intergenic
1142605886 17:1080796-1080818 CTGTGTCTCTGGCTGGTGCCTGG + Intronic
1142708081 17:1709048-1709070 CTCTGCCCCCAGCTGGTGCTTGG - Intronic
1142982210 17:3678840-3678862 CTGTGCGGTGAGCAGGTGCCTGG - Intronic
1143032835 17:3977240-3977262 CTGGGCCTCGAGCTGCTGTCTGG + Intergenic
1147661872 17:42121154-42121176 CTGGGGCAGGGGCTGGTGCCGGG + Exonic
1149852063 17:60043661-60043683 CTGTGTCTCCAGTTGGTGCCTGG + Exonic
1149992646 17:61391482-61391504 CTGTGCCTAGAGCTTCTGCCTGG - Intronic
1150131590 17:62672131-62672153 CTGTGTCACCATCTGGGGCCCGG + Exonic
1151161832 17:72172491-72172513 CAGAGACAGGAGCTGGTGCCTGG - Intergenic
1151402470 17:73864828-73864850 CTGAGCCTTTAGCTGGTGCCAGG - Intergenic
1151821052 17:76497157-76497179 CTGTGCCAGCAGGTGGTGCAGGG - Intronic
1152870035 17:82748892-82748914 CTGCGCCTGGAGCCGGTGCCGGG - Exonic
1152901067 17:82941461-82941483 CTGGGGCACCAGCTGGGGCCTGG - Exonic
1153948687 18:10038933-10038955 ATTTGCCACTAGCTGGTGCCTGG + Intergenic
1158966043 18:62623155-62623177 CTTTGTCACAGGCTGGTGCCAGG - Intergenic
1159415902 18:68149044-68149066 CTGTGCCACCAGCTGCTGCTGGG - Intergenic
1160510486 18:79450842-79450864 CAGCCCCACGAGCTCGTGCCAGG - Intronic
1160681361 19:413021-413043 CTATGCCACCAGCTGATACCCGG + Intergenic
1160681370 19:413058-413080 CTATGCCACCAGCTGATACCTGG + Intergenic
1160814520 19:1028936-1028958 CTGGGCTACGAGCTGTTTCCAGG + Intronic
1162302873 19:9854156-9854178 CTGTGGCTCGGGCTGCTGCCTGG - Exonic
1163551363 19:17967758-17967780 CAGTGCCCCGAGCTGGGTCCGGG - Intronic
1163696980 19:18768990-18769012 CTGAGGCACGAGCAGGTGGCTGG + Intronic
1163772050 19:19197192-19197214 CTGTGCTGCGAGCTGGTGGATGG - Exonic
1163862906 19:19751528-19751550 GTGGGCCACGAGCTGCTTCCAGG + Intergenic
1164147647 19:22521907-22521929 CTGTGCCACTAGCTTGGCCCTGG - Intronic
1164158961 19:22614192-22614214 CTGTGCCACTAGCTTGGCCCTGG + Intergenic
1165708548 19:37993268-37993290 CTGTGCCAAGAGCTGGTTCAAGG - Intronic
925238340 2:2298684-2298706 CTGTGCCACCAGCAGCTTCCTGG + Intronic
926690001 2:15726517-15726539 CTGTGCCCCGAGCTTGTGTTTGG + Intronic
927247098 2:20965849-20965871 CAGTGCCCAGAGCTGGTGCTGGG + Intergenic
928403862 2:30999219-30999241 CTGTGTCACTAGCTGGACCCAGG - Intronic
929564440 2:42975653-42975675 CAGTGCCCCGAGCTGGGGCTTGG + Intergenic
934767035 2:96885456-96885478 CAGTACCACGAGCAGGAGCCAGG - Intronic
935328819 2:101961689-101961711 CTGTGCCATTTGCTGGTGCTGGG + Intergenic
937037872 2:118796789-118796811 CTGAGCCAGGAGTGGGTGCCTGG - Intergenic
937280256 2:120712793-120712815 CTGTGCCAACACCTGGAGCCAGG + Intergenic
937436645 2:121886987-121887009 CTGTGTCAGGAACTGGGGCCAGG + Intergenic
939067830 2:137505555-137505577 CTGTGCCACGTGATCATGCCTGG + Intronic
941574902 2:167217382-167217404 CTGTGCTCAGAGCTGATGCCTGG + Intronic
948798642 2:240420179-240420201 CTCTGCCACCAGCTGGGGCTTGG - Intergenic
948865342 2:240772158-240772180 CTGAGCCAAGAGCTGGGGACAGG + Intronic
1169340104 20:4790087-4790109 CTGTGCCCCCAGCTGGTGTATGG - Intronic
1169758846 20:9069178-9069200 CTTTGCCTGGAGCTGCTGCCGGG - Intronic
1170160147 20:13302500-13302522 CAGGGCCCCAAGCTGGTGCCAGG + Intergenic
1170498526 20:16950686-16950708 CTGTGCCACCAGCTGATGCAGGG - Intergenic
1171178617 20:23074732-23074754 CCGTGCCATGAGCTGGAGACAGG + Intergenic
1172063746 20:32205386-32205408 CTGGCCCAGGAGATGGTGCCTGG - Intronic
1172688208 20:36773317-36773339 CTGTGTCACAAGCTTGGGCCAGG - Intronic
1175265300 20:57699533-57699555 CTGTGCAACTACCAGGTGCCAGG + Intronic
1180592989 22:16956494-16956516 CTGCCCCACTTGCTGGTGCCAGG + Intergenic
1183304367 22:37074405-37074427 CTGTCCCACGAGGTGGTCTCGGG + Intronic
1184365898 22:44051160-44051182 CTTTTCCACGAGCTGGTGGTAGG - Intronic
1185038189 22:48490321-48490343 CTGGGGCCCGAGCTGGTGACCGG + Intronic
950670298 3:14521817-14521839 CTGTGCCCAGTGCTGCTGCCGGG - Intronic
950794109 3:15496586-15496608 CTGAGCCACGTGCTGCTCCCAGG - Intronic
952953627 3:38543364-38543386 CTGTGCCAGGTGCTGGGGCAGGG + Intergenic
953450300 3:42999857-42999879 CTGTGTTACTAGCTTGTGCCAGG + Intronic
953927874 3:46991555-46991577 CTGGGCCACGAGGAGGTGCGCGG - Exonic
954334894 3:49910502-49910524 GAGTGCCACGAGCTGGTTGCGGG + Exonic
955539097 3:59955290-59955312 CTATCCCAGGAGCCGGTGCCGGG - Intronic
956681587 3:71785937-71785959 CTGTGCCTGGAGCTGGCGCGGGG - Intergenic
958928837 3:100187747-100187769 CTGTGCCACATGGTGGAGCCTGG - Intronic
962929259 3:140022223-140022245 CTGTGACTCTAGCTGGAGCCTGG + Intronic
967188264 3:186963885-186963907 CTGTCCCAAGCCCTGGTGCCAGG + Exonic
967887503 3:194343070-194343092 CTGTGCAAAGAGCAGGTGCCAGG - Intronic
968664852 4:1815388-1815410 CAGTGCCACCAGCTGGGGGCGGG + Intronic
969489594 4:7491476-7491498 CCATGCCGCGTGCTGGTGCCTGG - Intronic
970518972 4:16863546-16863568 CTCTGCAAGGAGCTGGAGCCAGG + Intronic
975118452 4:70704787-70704809 CTCGGCCACGGGCTGGCGCCTGG - Intronic
976239471 4:82939583-82939605 CTGTTCCCGGAGCTGGTGCCAGG + Exonic
982277966 4:153656214-153656236 CTGTGCCAGGAACTGGTACAGGG - Intergenic
995978446 5:118071994-118072016 TTGTGCTACGAGGTTGTGCCTGG + Intergenic
998132079 5:139656277-139656299 CTGTGGCAAGAGCAGGGGCCAGG - Intronic
1002345563 5:178545740-178545762 CTGTGCCTGCAGCTTGTGCCAGG - Intronic
1003656896 6:8020298-8020320 CTCTGCCCCTAGCTGGGGCCAGG - Intronic
1006171496 6:32095893-32095915 CTGTGCCACCCGCATGTGCCCGG - Intronic
1011586259 6:88928482-88928504 GTGTTCCACGAGCTGGTGCCTGG + Intronic
1013296896 6:108765631-108765653 CAGTGCCACAGGCTGCTGCCTGG - Intergenic
1017042672 6:150320120-150320142 CTGTGTGACGAGCATGTGCCAGG - Intergenic
1019342994 7:517319-517341 GTGCGCCCCGAGCTGGGGCCGGG - Intronic
1019652589 7:2168500-2168522 CTGTGGCCCCAGCTGGTCCCTGG + Intronic
1019767285 7:2861016-2861038 CTGTGGCACCAGCTCCTGCCTGG + Intergenic
1020007690 7:4791158-4791180 CTGTGCGTGGAGCTGGTGGCTGG - Exonic
1021100820 7:16584965-16584987 CAGTGCCTCCTGCTGGTGCCAGG + Intergenic
1022939836 7:35223616-35223638 CTGTGCCAAGGGCTGCTGACAGG + Intronic
1023659143 7:42455335-42455357 GTGAGCCCCGAGCTGGTGCAGGG + Intergenic
1023931083 7:44707132-44707154 CTGTGCCAGGGACTGCTGCCAGG - Intronic
1026213282 7:68325694-68325716 CTGTTGCATAAGCTGGTGCCTGG + Intergenic
1029741455 7:102493871-102493893 CTGCGCCACGCCCTGGTGCACGG + Exonic
1030076722 7:105743267-105743289 CTGTGCCAAGAACTGGGGCCAGG + Intronic
1031528470 7:122849925-122849947 CTGGGCCAGGAGCTGGGGCCTGG - Intronic
1032836378 7:135678998-135679020 CTGTGCCAGCAACTGCTGCCAGG - Intronic
1033777137 7:144624634-144624656 CTATGCAACAAACTGGTGCCTGG - Intronic
1034936828 7:155205362-155205384 CTGAGACACGATCTGGAGCCCGG - Intergenic
1035302141 7:157904496-157904518 CAGTGCCCTGAGCAGGTGCCGGG + Intronic
1037367455 8:18138133-18138155 CTGTGCCACTAGGTGGTTTCTGG - Intergenic
1037399202 8:18476648-18476670 CTCTGCCACCAGCTGGTGTGAGG + Intergenic
1038565481 8:28616789-28616811 CTGTGTCACCAGCTGTTTCCTGG - Intronic
1039978000 8:42383495-42383517 CTGTGCAATGTGCTGGTGCAGGG + Intergenic
1040522356 8:48189170-48189192 CTGTGCCAAGACATGGTGCTGGG - Intergenic
1042723839 8:71851030-71851052 CTGTACTACGTGCTGGTGACAGG + Intronic
1044491304 8:92819385-92819407 CCTTGTCACGAGCTGGTACCGGG - Intergenic
1047203589 8:122785807-122785829 CTGTGCAAAGAGATGATGCCAGG + Intronic
1048967106 8:139623381-139623403 CTGTGCCAAGAGCAGGTCCCAGG - Intronic
1049322615 8:142004885-142004907 CTGGGCCTGGAGCAGGTGCCCGG - Intergenic
1058756426 9:108086848-108086870 CTGAGACACGGGCTGGTTCCTGG + Intergenic
1060216892 9:121743833-121743855 CTGTCACAGGAGCTGGTCCCAGG + Intronic
1061222032 9:129257890-129257912 CAGTGCCAAGAGCTGGGGGCAGG - Intergenic
1061594883 9:131622329-131622351 AAGTGCCACGAGCAGCTGCCAGG + Intronic
1061754045 9:132800264-132800286 CAGTGCCAGGACCTGGCGCCAGG + Intronic
1062452056 9:136619975-136619997 TTGTGCAACGAACTGGGGCCCGG + Intergenic
1062459537 9:136657143-136657165 CTGTGCCATGTACTGGCGCCAGG + Intergenic
1062523299 9:136968527-136968549 CTGTGTCAGGAGCTGCAGCCAGG - Intergenic
1203444432 Un_GL000219v1:42055-42077 CTGTGCCTCGCCCTGGAGCCTGG + Intergenic
1186878249 X:13838636-13838658 CTCAGCCCCCAGCTGGTGCCTGG - Intronic
1187146532 X:16642523-16642545 GGGTTCCACCAGCTGGTGCCTGG - Intronic
1195037261 X:100981414-100981436 CTGTGCCATGTGGTGCTGCCAGG + Intronic
1196069974 X:111509615-111509637 CTTTGCCCAGAGCTGTTGCCAGG - Intergenic