ID: 922792770

View in Genome Browser
Species Human (GRCh38)
Location 1:228319205-228319227
Sequence CCTACCTCAAGAAGGCTGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 175}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922792761_922792770 -8 Left 922792761 1:228319190-228319212 CCCCTTCCCTGGTCACCTACCTC 0: 1
1: 0
2: 4
3: 35
4: 447
Right 922792770 1:228319205-228319227 CCTACCTCAAGAAGGCTGGGAGG 0: 1
1: 0
2: 2
3: 20
4: 175
922792763_922792770 -10 Left 922792763 1:228319192-228319214 CCTTCCCTGGTCACCTACCTCAA 0: 1
1: 0
2: 0
3: 26
4: 293
Right 922792770 1:228319205-228319227 CCTACCTCAAGAAGGCTGGGAGG 0: 1
1: 0
2: 2
3: 20
4: 175
922792754_922792770 22 Left 922792754 1:228319160-228319182 CCAGCTCTGATGATGAGTCCCGG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 922792770 1:228319205-228319227 CCTACCTCAAGAAGGCTGGGAGG 0: 1
1: 0
2: 2
3: 20
4: 175
922792762_922792770 -9 Left 922792762 1:228319191-228319213 CCCTTCCCTGGTCACCTACCTCA 0: 1
1: 0
2: 5
3: 28
4: 324
Right 922792770 1:228319205-228319227 CCTACCTCAAGAAGGCTGGGAGG 0: 1
1: 0
2: 2
3: 20
4: 175
922792759_922792770 3 Left 922792759 1:228319179-228319201 CCGGGCAGGCACCCCTTCCCTGG 0: 1
1: 0
2: 0
3: 55
4: 417
Right 922792770 1:228319205-228319227 CCTACCTCAAGAAGGCTGGGAGG 0: 1
1: 0
2: 2
3: 20
4: 175
922792758_922792770 4 Left 922792758 1:228319178-228319200 CCCGGGCAGGCACCCCTTCCCTG 0: 1
1: 0
2: 7
3: 49
4: 472
Right 922792770 1:228319205-228319227 CCTACCTCAAGAAGGCTGGGAGG 0: 1
1: 0
2: 2
3: 20
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922792770 Original CRISPR CCTACCTCAAGAAGGCTGGG AGG Exonic
900838988 1:5032135-5032157 TGCAGCTCAAGAAGGCTGGGAGG - Intergenic
901273153 1:7969424-7969446 TATACCTCAATAAAGCTGGGGGG + Intronic
902659716 1:17892633-17892655 TCTTCCCCAAGGAGGCTGGGTGG + Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903389267 1:22952987-22953009 CCTTACTCTAGAAAGCTGGGAGG + Intergenic
904353641 1:29924685-29924707 CCCACCTCTAGGAGGCTGAGAGG - Intergenic
905274944 1:36811333-36811355 AGTAACTAAAGAAGGCTGGGGGG + Intronic
905711122 1:40104547-40104569 TATACCTCAATAAAGCTGGGGGG - Intergenic
907323051 1:53617836-53617858 CCTACCTGAAGAAGGATGGCTGG - Intronic
909385454 1:75050473-75050495 CATGCCTCAATAAAGCTGGGTGG + Intergenic
909670378 1:78182010-78182032 CCTGCCTCAACAAGTCAGGGTGG + Intergenic
909942757 1:81630256-81630278 CTTTCCTGGAGAAGGCTGGGAGG - Intronic
911423906 1:97681973-97681995 CCCACCTCAAAAAGGATGGGAGG - Intronic
912449489 1:109760449-109760471 CCTACCACAAGAAGCCTGGGTGG - Intronic
915250885 1:154587776-154587798 ATTACCTCAAGAAAGCGGGGAGG - Intronic
921295054 1:213693604-213693626 CCTTCCTCAGGCAGGCAGGGTGG - Intergenic
922792770 1:228319205-228319227 CCTACCTCAAGAAGGCTGGGAGG + Exonic
1063697390 10:8350013-8350035 CAAACCTCAAAAAGGCTGGGAGG + Intergenic
1064263990 10:13809676-13809698 TCTTCCTCAAGAAAGCTGGGAGG - Intronic
1065000491 10:21333654-21333676 TATACCTCAATAAAGCTGGGAGG + Intergenic
1067997667 10:51293046-51293068 CATACCTCAATAAAGCTGGGGGG - Intronic
1068661415 10:59627099-59627121 CCTCCGTCAAGCTGGCTGGGTGG - Intergenic
1069817819 10:71209768-71209790 GGTACATCAATAAGGCTGGGGGG - Intergenic
1073323826 10:102631168-102631190 CCTACAGCCTGAAGGCTGGGAGG - Exonic
1074205242 10:111277413-111277435 ACAACCTAAACAAGGCTGGGAGG - Intergenic
1077183081 11:1225007-1225029 CCAACCCCATGGAGGCTGGGAGG - Intronic
1078519925 11:12054533-12054555 TATACCTCAATAAAGCTGGGAGG - Intergenic
1079084253 11:17433874-17433896 CCTTCCTCATGAAGGCTAGATGG + Intronic
1080583997 11:33665674-33665696 CCTACCTTCAGAAGGCCAGGGGG - Intronic
1082863039 11:57873535-57873557 TATACCTCAAGATGGCTGGGGGG + Intergenic
1082883468 11:58060471-58060493 CCTGCCTAAGGAAAGCTGGGAGG + Intronic
1083060750 11:59868378-59868400 CCTAGCTCAAACAGGCTGGCAGG - Intergenic
1083732024 11:64657453-64657475 TTTCCTTCAAGAAGGCTGGGTGG + Intronic
1083864588 11:65446586-65446608 CAAACCTCAACAAGGCTGAGGGG + Intergenic
1086320288 11:85639242-85639264 ACTACCACAAGAAAGCTTGGGGG + Intergenic
1089362161 11:117898127-117898149 CCTACATCAAGGAGACTTGGAGG + Intergenic
1091491261 12:934762-934784 CATACCTCAAAAAAGCTGGGGGG + Intronic
1091587175 12:1822916-1822938 CCAACCCCAGGAAGGCTGAGAGG - Intronic
1092405257 12:8217337-8217359 CCTACCTCATGAAGGTGGGTGGG + Intergenic
1097054281 12:56240521-56240543 CCTCCCCCATGAAGACTGGGGGG + Exonic
1097513941 12:60579376-60579398 CCTACCTCCCGAAGGCTGAGGGG + Intergenic
1098288775 12:68934781-68934803 CCTACCTAAATAAGGTTGGCAGG + Intronic
1103393247 12:120589264-120589286 CCTCCCTCAAGGACCCTGGGGGG + Intergenic
1104494361 12:129223041-129223063 TATACCTCAATAAAGCTGGGGGG + Intronic
1105440593 13:20412730-20412752 GCTGCCTCCAGAAGGCTTGGGGG - Intronic
1106258271 13:28041187-28041209 CCGACCTCAGGAAGGCAGTGTGG + Intronic
1113462400 13:110491357-110491379 CCTGCCTGAGGAAGGCTGTGTGG - Intronic
1115809643 14:37092464-37092486 CCTACCTAAACAACACTGGGGGG - Intronic
1117519921 14:56541157-56541179 CTTACCTGCAGAAGCCTGGGTGG + Intronic
1119783113 14:77291653-77291675 CCTCCCTCTAGAAGGCTGGATGG - Intronic
1120381351 14:83784006-83784028 CTTACCTCAGGAGGGCAGGGAGG + Intergenic
1124406378 15:29395965-29395987 CATACCTCAATAAAGCTGGGAGG - Intronic
1125800998 15:42446872-42446894 CCTACCTCTAGGATGCTAGGAGG - Intronic
1129607490 15:77031921-77031943 TCTACCTCAAGGAGGCGAGGAGG - Intronic
1130064916 15:80595306-80595328 CCTACCTGAAGGACTCTGGGAGG - Exonic
1131584971 15:93683419-93683441 GTTACATTAAGAAGGCTGGGTGG + Intergenic
1132699003 16:1214316-1214338 CCTTCTTCTAAAAGGCTGGGAGG - Intronic
1132771439 16:1565619-1565641 CCTGGCTCACGCAGGCTGGGCGG + Intronic
1136093184 16:27935286-27935308 ACTAGCTCAGGAAGGCTGGCCGG - Intronic
1137481984 16:48859451-48859473 GCTTCATCAAGGAGGCTGGGAGG - Intergenic
1137629827 16:49935111-49935133 CCTACACCAACAAGGCTGGGAGG + Intergenic
1137876167 16:51998589-51998611 CCTACCTCAGGAGGGCAGGCAGG - Intergenic
1138342180 16:56297169-56297191 CTTGCCTCAAGCAAGCTGGGAGG - Intronic
1138559837 16:57794914-57794936 CCTACCCCCAGAAGCCTGGCAGG + Intronic
1140033126 16:71354254-71354276 ACTCCCTCAAGAAGGGAGGGAGG - Intergenic
1141064480 16:80902769-80902791 TCTCCCTCCAGGAGGCTGGGTGG - Intergenic
1143342486 17:6224173-6224195 GCTACCTCAAGAAACTTGGGGGG + Intergenic
1144092552 17:11871062-11871084 CCAACCCAAAGAGGGCTGGGGGG + Intronic
1144805527 17:17964121-17964143 CCTAAATCAAGAAGGTTGGAGGG + Intronic
1146467450 17:33097309-33097331 CCTGCCTCAGGACAGCTGGGAGG - Intronic
1147383886 17:40070821-40070843 CCCACCCCATGCAGGCTGGGGGG - Intronic
1148193624 17:45697838-45697860 CCTAGCAGAAGAAGGCTGTGTGG - Intergenic
1148554999 17:48573154-48573176 CCTCCAGGAAGAAGGCTGGGGGG + Intronic
1148775266 17:50091714-50091736 GCCACCACAAGGAGGCTGGGAGG - Intergenic
1149061581 17:52428906-52428928 CCTATATCAAGAATGCTGGCTGG + Intergenic
1153552047 18:6272321-6272343 CCTACCTCATGAAGGAGGTGAGG - Intronic
1156852552 18:41745311-41745333 CCAGCCTCAATAAGGCTGGGTGG + Intergenic
1157367031 18:47074727-47074749 ACTACCTCAACAAGGCTGCTTGG - Intronic
1159773045 18:72570618-72570640 CCAAGCACAAGAAGGCTGTGAGG - Intronic
1160939141 19:1611993-1612015 CCTTCCTTGAGAAGGCTGGGGGG + Intronic
1161087468 19:2341625-2341647 GCTGCCTCAGGAAGGCTGGGAGG - Intronic
1161297183 19:3526044-3526066 CCTAGAGCAAGGAGGCTGGGAGG - Intronic
1161982202 19:7635919-7635941 CCGAGCTTAAGAAGGCTGGAGGG - Intronic
1162728308 19:12702769-12702791 CCCACCTCCAGAAGGCAGGCAGG + Intronic
1166317772 19:41998507-41998529 CCCACCTCCAGAAGCGTGGGGGG + Exonic
1167735226 19:51290464-51290486 CCAGCCTCCAGAATGCTGGGAGG - Intergenic
925579415 2:5395424-5395446 CCTGCCTTAAGATGGCTGGCTGG - Intergenic
926358738 2:12065402-12065424 CCTCCCTGGAGAAGGCAGGGAGG + Intergenic
927299177 2:21491379-21491401 TGTACCTCAATAAAGCTGGGGGG - Intergenic
929646257 2:43631631-43631653 CATACCTGAAGAGGGCTGGGAGG + Intergenic
929822701 2:45286175-45286197 CCGACCTGCAGCAGGCTGGGAGG + Intergenic
930051671 2:47220804-47220826 CCTACCTCATGGAGTTTGGGAGG + Intergenic
931028632 2:58144520-58144542 CATATCTCAATAAAGCTGGGAGG + Intronic
933839663 2:86276252-86276274 CCTGCTTCCAGAAGGCTGGCTGG - Intronic
934308317 2:91843398-91843420 CCTACCACAGGAGGGCTGGTGGG - Intergenic
936552411 2:113457629-113457651 TGTACCTCAATAAAGCTGGGGGG - Intronic
937156792 2:119725416-119725438 CCTACCTCAAGACAGGTGTGAGG - Intergenic
937939651 2:127275108-127275130 CCTTTCTTATGAAGGCTGGGAGG + Intronic
938153749 2:128909937-128909959 CCTCACTGAAGGAGGCTGGGGGG - Intergenic
941695506 2:168546924-168546946 CCTACGTCAAGAGGAATGGGAGG - Intronic
942149338 2:173058994-173059016 CCTGCCTCACAAAAGCTGGGGGG + Intergenic
946308249 2:218868337-218868359 CCTCCCTTAAGAAGGCAGGAGGG - Intronic
946677771 2:222180705-222180727 CTAACCTCAAAAAGGGTGGGAGG - Intergenic
948663115 2:239518804-239518826 CCTACCTCCACAAAGCTGAGGGG + Intergenic
948989152 2:241543045-241543067 GCTGCCTCCAGGAGGCTGGGCGG - Intergenic
1169275063 20:4228186-4228208 CCTACATCCAGAAGGATGAGGGG - Intronic
1170740634 20:19053057-19053079 CCTATCTCAGGATGGCTGTGGGG - Intergenic
1170941778 20:20854128-20854150 CCTGCCCCAAGAAGGCTCCGAGG - Intergenic
1172409000 20:34708960-34708982 CCCACCTCCAGTAGGCTTGGGGG - Intronic
1172421080 20:34818388-34818410 CCTACCCAAAGAACACTGGGGGG + Intronic
1173551914 20:43938330-43938352 CCTACCTCAGGCAGGAGGGGAGG - Intronic
1175778412 20:61667205-61667227 CCACCCTCAGGAAGGCTGAGAGG + Intronic
1176373738 21:6077244-6077266 GCTTCCTCCAGGAGGCTGGGTGG + Intergenic
1178244283 21:30936290-30936312 CCTGCCCCAAGAGGACTGGGAGG - Intergenic
1178671044 21:34591990-34592012 CATGCCTTAAGAAAGCTGGGGGG + Intronic
1179749739 21:43460999-43461021 GCTTCCTCCAGGAGGCTGGGTGG - Intergenic
1182469751 22:30541308-30541330 CATACCTTAATAAAGCTGGGAGG - Intronic
1182930213 22:34166412-34166434 CTTACCTCAATAAAGCTGGAGGG - Intergenic
1183394383 22:37562805-37562827 GCTGCCTCAAGAAGTCAGGGAGG + Intronic
1185156257 22:49195213-49195235 GGAACCTCAGGAAGGCTGGGAGG - Intergenic
949369046 3:3314941-3314963 CCTACCTCATTGATGCTGGGAGG - Intergenic
950199650 3:11034136-11034158 CCCACCTCAAGAACCTTGGGTGG - Intronic
950952127 3:17011530-17011552 CCTCCCTCATGATGGCTGGCCGG - Exonic
951168217 3:19507395-19507417 CCTGCCTCATGAAGAGTGGGGGG + Intronic
951435990 3:22665508-22665530 CATAACTCATGAAGGGTGGGGGG - Intergenic
952416044 3:33092471-33092493 CATACCTCTAGAAGGTGGGGCGG - Exonic
962665359 3:137648858-137648880 ACTACATCAACAAGGCTGGCTGG - Intergenic
964823736 3:160802562-160802584 CCTACCACAAGAATGCTCTGAGG - Intronic
967651058 3:191987693-191987715 TATACCTCAATAAAGCTGGGGGG - Intergenic
969760857 4:9180634-9180656 CCTACCTCATGAAGGTGGGTGGG - Intergenic
971345015 4:25803736-25803758 CCTGCCTCAAGCAGGCAGGCAGG - Intronic
971998811 4:34001834-34001856 GCTCACTTAAGAAGGCTGGGGGG - Intergenic
972782027 4:42294614-42294636 CCTACCCCCACAAGGCTGGAAGG - Intergenic
974877482 4:67716634-67716656 CATACTTGATGAAGGCTGGGTGG + Intergenic
977670371 4:99688095-99688117 TGTACCTTAATAAGGCTGGGGGG - Intergenic
978107133 4:104916738-104916760 CCTACCTCAAGGGGCCTGAGGGG - Intergenic
979510062 4:121542380-121542402 CATACCTCAAAAATGCTGGAGGG + Intergenic
980833297 4:138157826-138157848 CCTAACTCAAGTAGGCTGTCTGG - Intergenic
981144339 4:141307605-141307627 CCTACCACAAGAAGGAGGGCTGG + Intergenic
982483912 4:155944611-155944633 CCTATAGAAAGAAGGCTGGGAGG - Intronic
984580898 4:181509002-181509024 CCTACCCAAAGAAAGGTGGGAGG - Intergenic
987963294 5:24838340-24838362 CCCACCTCAAGTGGGCAGGGGGG + Intergenic
989155409 5:38340175-38340197 TATACCTAAACAAGGCTGGGAGG + Intronic
993575543 5:89595218-89595240 CTTACCCCAAGGAGCCTGGGGGG - Intergenic
994652455 5:102545801-102545823 CCTACTTTAAGAAGGCTAGATGG - Intergenic
996777346 5:127146890-127146912 TTTACCTCAATAAAGCTGGGGGG - Intergenic
997264781 5:132489187-132489209 CCTACCTCAAGAAGGGAAGAAGG + Intronic
997760227 5:136439684-136439706 TATACCTCAATAAAGCTGGGGGG - Intergenic
999126954 5:149252903-149252925 TCCAGCTCAAGAGGGCTGGGTGG + Intronic
999365740 5:151022259-151022281 CCTGCCTCAAGAAGGCTAGTGGG + Intronic
1000238034 5:159381256-159381278 CCTACATCAAGAAGTCTGAAAGG + Intergenic
1001621839 5:173093323-173093345 CATACCTCAATAAAGCTGGGGGG - Intronic
1002451012 5:179318507-179318529 CCTCTCACAAGAAGGCTGGTGGG + Intronic
1002870754 6:1165629-1165651 CCTGGCTCAAGAAGGCTGGGAGG - Intergenic
1004001553 6:11601332-11601354 CATACCTCAATAATGCTGGGGGG - Intergenic
1006942750 6:37763699-37763721 CCCACCAAGAGAAGGCTGGGGGG - Intergenic
1007167090 6:39836308-39836330 CCTTCTTTAAGAAGGCTGGAAGG - Intronic
1012076627 6:94694956-94694978 TATACCTCAGGAAAGCTGGGGGG - Intergenic
1014020569 6:116583672-116583694 TATACCTTAAGAAAGCTGGGGGG + Intronic
1016686971 6:146892811-146892833 CCTACCTCATGAAGAGTGGAAGG - Intergenic
1019188497 6:170235940-170235962 GCCAGCTCAGGAAGGCTGGGGGG + Intergenic
1022734503 7:33063133-33063155 CCGACCCCCAGAAGGCTGCGCGG + Intergenic
1025886118 7:65594605-65594627 AATACCTCAAAAAGGATGGGTGG - Intergenic
1029283337 7:99450520-99450542 CCTCTCCCAAGAATGCTGGGTGG + Intronic
1032527016 7:132585971-132585993 TCTAACTCAACAAGGCTGTGAGG + Intronic
1033036309 7:137879291-137879313 CCTACCTCAACAAAGCAGGGTGG - Exonic
1033982383 7:147181302-147181324 CCTTCCTCAAGAAAGGTGTGAGG - Intronic
1036270966 8:7302485-7302507 CCTACCTCATGAAGGTGGGTGGG - Intergenic
1036350383 8:8007859-8007881 CCTACCTCATGAAGGTGGGTGGG + Intergenic
1036845651 8:12168284-12168306 CCTACCTCATGAAGGTGGGTGGG + Intergenic
1036867019 8:12410603-12410625 CCTACCTCATGAAGGTGGGTGGG + Intergenic
1042065528 8:64870629-64870651 CCTACCTCTGGAAGGTTTGGGGG + Intergenic
1042080052 8:65041786-65041808 CCTACAGCAGTAAGGCTGGGAGG - Intergenic
1042994732 8:74683914-74683936 CCTACCTCAAGATGTCCTGGTGG + Intronic
1048329432 8:133461961-133461983 CATACTTGATGAAGGCTGGGTGG + Exonic
1048514240 8:135091363-135091385 CCTCCAGCAAGGAGGCTGGGAGG - Intergenic
1049814207 8:144590660-144590682 CCAGCCTGCAGAAGGCTGGGGGG + Intronic
1049900589 9:159554-159576 TATACCTCAATAAAGCTGGGGGG + Intronic
1053743632 9:41169838-41169860 TATACCTCAATAAAGCTGGGGGG + Intronic
1054348906 9:63999654-63999676 TATACCTCAATAAAGCTGGGGGG + Intergenic
1054483641 9:65695468-65695490 TATACCTCAATAAAGCTGGGGGG - Intronic
1054684711 9:68261420-68261442 TATACCTCAATAAAGCTGGGGGG - Intronic
1054711602 9:68516473-68516495 GTTACCTCAAGTAGGCTGTGGGG + Intronic
1057390484 9:94638609-94638631 CCCCCCGCAAGCAGGCTGGGAGG - Intronic
1058436451 9:104968305-104968327 CCGCCCACAAGAAGGCGGGGCGG + Intergenic
1058631853 9:106997113-106997135 TATACCTCAATAAAGCTGGGGGG - Intronic
1189329086 X:40131935-40131957 TCTACTTCTAGAAGTCTGGGTGG + Intronic
1191108724 X:56788762-56788784 CGTATCTCAAAATGGCTGGGGGG + Intergenic
1191111078 X:56803463-56803485 CCCACCTCAAGATGGCTGCCAGG + Intergenic
1192600613 X:72459713-72459735 CCTACCTCAAGCAGCTAGGGAGG - Intronic
1194753770 X:97713357-97713379 CCTACCTCAGGATTGCTGTGAGG - Intergenic
1196403546 X:115341141-115341163 AATACCTTAAGAAGGATGGGAGG + Intergenic
1197091050 X:122538378-122538400 TGTATCTCAAGAAGGCTGTGAGG - Intergenic
1198127415 X:133659617-133659639 CCTCCCTCAAGGAGGCTGTGAGG + Intronic
1199055716 X:143291701-143291723 CCTCCCTCAAGAATGGTAGGGGG - Intergenic
1199296564 X:146165517-146165539 CCTACCTGAGGAAAGGTGGGAGG + Intergenic
1199471004 X:148196515-148196537 CCTAACACAAAATGGCTGGGTGG - Intergenic
1200144703 X:153920638-153920660 GCTCCCTCAAGAAGGGAGGGAGG - Exonic