ID: 922794315

View in Genome Browser
Species Human (GRCh38)
Location 1:228332530-228332552
Sequence CCATCCTACTAGGGAATAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922794315_922794324 23 Left 922794315 1:228332530-228332552 CCCATTATTCCCTAGTAGGATGG 0: 1
1: 0
2: 0
3: 6
4: 88
Right 922794324 1:228332576-228332598 ACTGTTTCTTCTGAGGCCCCTGG 0: 1
1: 0
2: 3
3: 27
4: 309
922794315_922794323 16 Left 922794315 1:228332530-228332552 CCCATTATTCCCTAGTAGGATGG 0: 1
1: 0
2: 0
3: 6
4: 88
Right 922794323 1:228332569-228332591 CACTATCACTGTTTCTTCTGAGG 0: 1
1: 0
2: 0
3: 22
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922794315 Original CRISPR CCATCCTACTAGGGAATAAT GGG (reversed) Intronic
907943757 1:59113518-59113540 CCATCCCACTAGGGAGCTATGGG + Intergenic
917023546 1:170615724-170615746 CCTTCCCACTTGGCAATAATTGG - Intergenic
917029582 1:170674272-170674294 CTAGCATACTAGGGAACAATAGG - Intronic
917570863 1:176263839-176263861 CCATCCTGCTAGGTAGTAAGCGG - Intergenic
921475286 1:215599813-215599835 CCATCCTCCCAGAGAATAAATGG + Intronic
922794315 1:228332530-228332552 CCATCCTACTAGGGAATAATGGG - Intronic
1063841704 10:10079891-10079913 CCATCCTACTTAGGCATTATGGG - Intergenic
1064313607 10:14234713-14234735 CCATCCTAATACGGGAGAATTGG - Intronic
1065906906 10:30263063-30263085 CCATAATACAAGGGAATTATGGG - Intergenic
1067273756 10:44816179-44816201 CCATTCTATTATGAAATAATTGG + Intergenic
1073832524 10:107402337-107402359 CCATCTGACAAGGGATTAATGGG - Intergenic
1079120632 11:17682019-17682041 CCATCCTACTAGTCTTTAATTGG - Intergenic
1079483335 11:20907564-20907586 CCATCCTATTAGAAAATAAGGGG + Intronic
1079699938 11:23532928-23532950 ACATGCTAATAGGGAGTAATAGG - Intergenic
1080173967 11:29339664-29339686 CCATGATACTTGGGAATTATGGG + Intergenic
1081388013 11:42495990-42496012 CCATCCAAAAAAGGAATAATGGG + Intergenic
1087549048 11:99623401-99623423 CCATCCTACTGGGGATGAAGTGG - Intronic
1089424253 11:118358308-118358330 CCATCCTAGTAGGTATTAAGTGG + Intergenic
1094153300 12:27310428-27310450 TAGTCCTACTAGGGTATAATAGG + Intronic
1097021531 12:56024321-56024343 CAATCTTAGTAGGGAAGAATTGG - Intronic
1099727288 12:86448173-86448195 CCATCCTTCTATGGAATTCTGGG - Intronic
1099730767 12:86497752-86497774 CCATGCTAATTGGAAATAATGGG - Intronic
1103297641 12:119901956-119901978 CCATCCTAATAGGGATGAAGTGG + Intergenic
1107251415 13:38367863-38367885 CAATCTTACTAGGAAATAATAGG - Intergenic
1107437930 13:40397661-40397683 CCATCCTAGTAGGTATTAAGTGG - Intergenic
1108839049 13:54589401-54589423 CAATCCTACTTTGGCATAATAGG - Intergenic
1112237534 13:97649773-97649795 TCACCCTACTAGAGAATATTTGG + Intergenic
1115856401 14:37633789-37633811 CCATCCTAGTTGGAAAGAATAGG - Intronic
1115880137 14:37906797-37906819 CATTGCTACTAGGGAATAATTGG - Intronic
1121333237 14:93061048-93061070 CCATACCACTAGGGAATCACTGG + Intronic
1125353280 15:38789980-38790002 CCAACCTACTAGGGTATTATTGG + Intergenic
1132342881 15:101089088-101089110 GCATCGTACTTGGGAATACTTGG - Intergenic
1137481705 16:48857285-48857307 CCATCCTACTGAGGGAAAATAGG + Intergenic
1144640319 17:16933241-16933263 CCATCTTCCTTGGGAATACTTGG + Intronic
1146227683 17:31081194-31081216 CCATCCTACTAGGCATGAAGTGG + Intergenic
1147254997 17:39176150-39176172 TCATCCGACTAGGGAATGGTGGG - Intronic
1150596730 17:66612562-66612584 CCATCCTAATAGGCATTAAAAGG - Intronic
1151635298 17:75343181-75343203 CCATCCTGAGAGGGATTAATAGG - Intronic
1163373218 19:16914203-16914225 CCATGCTACTAGGGGGAAATTGG - Intronic
1164619875 19:29688604-29688626 CCATCCTAGTAGGGAAAAAGTGG + Intergenic
1167404957 19:49300670-49300692 CCATCATGATAGGAAATAATTGG - Intronic
931879101 2:66547998-66548020 CCATCCTTCAAGTGAACAATTGG + Exonic
933036560 2:77406893-77406915 CCATCCTAGTGGGAAATAACTGG + Intronic
935895601 2:107734138-107734160 CCCTCCTTCTAGTGAAAAATTGG - Intergenic
941902004 2:170687748-170687770 CCTTCCTATTAGGGAATAACTGG - Intergenic
945896915 2:215493776-215493798 ACATAGTACTGGGGAATAATTGG - Intergenic
947462832 2:230318001-230318023 GCATCTAACTAGGGAATAAATGG - Intergenic
1172802628 20:37588239-37588261 CCATCCTACTAGGTATAAAGTGG - Intergenic
1173403962 20:42748849-42748871 CTATCCTACTAGGTAATTCTGGG - Intronic
1174411457 20:50339377-50339399 CCAGTCTACTGGGGCATAATGGG + Intergenic
1175556482 20:59862546-59862568 TCACCCTACTAGTGATTAATGGG - Intergenic
1175851073 20:62093276-62093298 CCATCCTAAAAGGGAGAAATAGG - Intergenic
1184315866 22:43688785-43688807 CCATCCTGTTAGGGAAGGATAGG - Intronic
949841760 3:8327575-8327597 CTCTCCTTGTAGGGAATAATGGG - Intergenic
950437735 3:12990814-12990836 CCATCATACAAGGGAATGATAGG + Intronic
951396192 3:22169948-22169970 CCATCTTACTGGACAATAATTGG - Intronic
951799571 3:26580640-26580662 CCATCCCACTGGGGACTATTTGG - Intergenic
955624798 3:60906928-60906950 CCATCCTACTATGGAAACAGAGG + Intronic
955909667 3:63847014-63847036 CCCTCCTACTAGTGAATTTTTGG - Intronic
958146095 3:89627447-89627469 CCATCCTACCAGGAATGAATGGG - Intergenic
959311892 3:104749047-104749069 CCATTCTAAAAGGGAAAAATAGG - Intergenic
963802787 3:149694091-149694113 CCATCTAACAAGGGATTAATAGG + Intronic
963817903 3:149854162-149854184 CCATCCTAATTAAGAATAATAGG - Intronic
965080853 3:164029775-164029797 CCATGCTTCTGTGGAATAATTGG + Intergenic
965765006 3:172121016-172121038 CCTTCCTACTTGGCAACAATTGG + Intronic
967150766 3:186647526-186647548 CCATCCTACTGGGCATGAATTGG + Intronic
982347325 4:154374361-154374383 CCATCCTAGAATTGAATAATGGG - Intronic
983086921 4:163457204-163457226 CCTTCTTACCAGGTAATAATTGG - Intergenic
986712227 5:10496351-10496373 CCATCCTGCAAGGGGAAAATGGG - Intergenic
991986815 5:72296855-72296877 TCTTCCTCCCAGGGAATAATGGG - Intronic
999704367 5:154258335-154258357 ACATTATGCTAGGGAATAATTGG + Intronic
1007292881 6:40800450-40800472 CAATCCTACTAGGGAAACGTGGG + Intergenic
1012241840 6:96881400-96881422 CTATCCTACAAAGGAATAAAAGG + Intergenic
1014876398 6:126666114-126666136 CCTTTCTCCTAGGGAATAAAAGG - Intergenic
1016248326 6:142014606-142014628 CCATCCCCTCAGGGAATAATAGG + Intergenic
1022253695 7:28634124-28634146 CCATTTTACAAGGGTATAATGGG - Intronic
1022409451 7:30127086-30127108 CCTTCTTACTAGGATATAATTGG + Intronic
1024808762 7:53182490-53182512 CCATCCTACTAGCTAATGTTTGG + Intergenic
1028047028 7:86133563-86133585 CCAACTTTCTAGGGAATAACGGG - Intergenic
1032054413 7:128672989-128673011 CCATCCTTTTAGGGAATGGTAGG - Intronic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1039660456 8:39456598-39456620 CCATCCTAATAGGTACAAATTGG + Intergenic
1040815804 8:51507707-51507729 CCATCCTCCCAGGGAATATCTGG + Intronic
1041262258 8:56031967-56031989 CCATCCAATAAGGGATTAATAGG + Intergenic
1044542907 8:93427934-93427956 CTTTCCTACTAGGGAAGAACAGG + Intergenic
1046645236 8:116778564-116778586 CCATCCTACTAGGTATGAAATGG - Intronic
1047333170 8:123910944-123910966 CCATCCCACTAGGAAGTCATAGG - Intronic
1060376359 9:123118068-123118090 CCATCCTGCTATGGATTAAAAGG - Intronic
1061330215 9:129887692-129887714 CCATCCTACAAAGGAAAAACTGG + Exonic
1187935579 X:24332588-24332610 CCATCCTCCTAGACAATGATTGG - Intergenic
1195371355 X:104177650-104177672 CCATCCTACTGGGTATAAATTGG + Intronic
1196683702 X:118494044-118494066 CCATCCCACTAGTCAATAAGAGG + Intergenic
1196966844 X:121065545-121065567 CCATAATACAAGGGAATTATGGG - Intergenic
1199083026 X:143597265-143597287 ATAACATACTAGGGAATAATAGG - Intergenic
1201406686 Y:13657156-13657178 CCATCTTACTAGGGGCTTATTGG + Intergenic