ID: 922797004

View in Genome Browser
Species Human (GRCh38)
Location 1:228345202-228345224
Sequence CTCGGTTATAAGGACTGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 34}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922797004_922797010 7 Left 922797004 1:228345202-228345224 CCAGTTCAGTCCTTATAACCGAG 0: 1
1: 0
2: 1
3: 3
4: 34
Right 922797010 1:228345232-228345254 CTGGTGTTGCAGGCACCATCTGG 0: 1
1: 0
2: 3
3: 88
4: 375
922797004_922797011 8 Left 922797004 1:228345202-228345224 CCAGTTCAGTCCTTATAACCGAG 0: 1
1: 0
2: 1
3: 3
4: 34
Right 922797011 1:228345233-228345255 TGGTGTTGCAGGCACCATCTGGG 0: 1
1: 0
2: 0
3: 20
4: 285
922797004_922797008 -3 Left 922797004 1:228345202-228345224 CCAGTTCAGTCCTTATAACCGAG 0: 1
1: 0
2: 1
3: 3
4: 34
Right 922797008 1:228345222-228345244 GAGTGCTGTCCTGGTGTTGCAGG 0: 1
1: 0
2: 1
3: 18
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922797004 Original CRISPR CTCGGTTATAAGGACTGAAC TGG (reversed) Intronic
908292130 1:62678267-62678289 GTCAGTTATAAGGATTGAAAAGG + Intronic
913259925 1:116988689-116988711 CTCGGTGATAAGTGCAGAACCGG - Exonic
916647134 1:166797273-166797295 CTCGGTTGGCAGCACTGAACAGG - Intergenic
922797004 1:228345202-228345224 CTCGGTTATAAGGACTGAACTGG - Intronic
1064853939 10:19743608-19743630 ATAAGTTATAAGGACTGAAAAGG + Intronic
1069061499 10:63899504-63899526 CTCTCTTATAAGGACTCTACAGG + Intergenic
1074974592 10:118569826-118569848 CTGGGGTAGAAGGCCTGAACTGG - Intergenic
1081199212 11:40196140-40196162 CTCGTGGATAAGGATTGAACAGG + Intronic
1082853642 11:57787323-57787345 CTAGGTTCTAAGGAGTGAATGGG - Intronic
1087919790 11:103853547-103853569 ATCTGCTATAAGGACTGAACAGG - Intergenic
1090600424 11:128364220-128364242 GTCGGCTATAAGGCCTGAAATGG + Intergenic
1114575226 14:23706782-23706804 CTTGGTTATAAAGACTGAGGAGG + Intergenic
1121329348 14:93040346-93040368 CTGGGGTATAAGGACAGAGCAGG + Intronic
1122503339 14:102216287-102216309 CTCTGTTCTTAGCACTGAACAGG + Intronic
1122850464 14:104525601-104525623 CTGGGTGGGAAGGACTGAACAGG + Intronic
1130655874 15:85791922-85791944 CTGGGTTAAAAGGACTTAACAGG + Intronic
1140199830 16:72886219-72886241 ATCAGTTATATGGACCGAACTGG + Intronic
1145916145 17:28575239-28575261 CACGGTCATCAGCACTGAACAGG + Exonic
1157206879 18:45708180-45708202 CTGGGTATTAAGGACTGAATAGG - Intergenic
928425457 2:31174258-31174280 CTAGGTTTTAAGGTCTGAAATGG - Intronic
929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG + Intronic
932538299 2:72622980-72623002 AAAGGTTATAGGGACTGAACTGG + Intronic
940969177 2:159876514-159876536 CGTGGATAGAAGGACTGAACAGG - Intronic
1176696939 21:9989537-9989559 CTCTGTCTTAAGAACTGAACTGG - Intergenic
1177621527 21:23601443-23601465 CTGGATTATAAAGAATGAACAGG + Intergenic
1179513778 21:41892487-41892509 CTGGGTTCTAAGGACTGAACAGG - Intronic
1185319561 22:50194230-50194252 CTGGGTTCTGAGAACTGAACAGG - Intronic
968805642 4:2770249-2770271 CTTGGTTCTAAGCACTCAACAGG - Intergenic
970273314 4:14369564-14369586 CTCTGGTATATGGATTGAACAGG + Intergenic
980475878 4:133315697-133315719 CATGGTGATAAGGACTGAATAGG + Intergenic
988728425 5:33946525-33946547 CTCTGTTATAAGCACTGCATAGG + Intronic
1005973486 6:30779540-30779562 CTTGGTTATAAAGACTGAGGAGG + Intergenic
1008075144 6:47138170-47138192 CTCGGTTATAGGAGCTGAGCTGG + Intergenic
1012612933 6:101237647-101237669 CTCTGTTATGAGGACTGCACAGG - Intergenic
1031482728 7:122298888-122298910 CTTTGTTATAAGGTCTGATCTGG - Intergenic
1052458004 9:28725895-28725917 CAAGGTTATAAGCACTGAAAGGG + Intergenic
1053031500 9:34783152-34783174 TTAAGTTCTAAGGACTGAACTGG - Intergenic
1189644800 X:43116455-43116477 CTATTTTAGAAGGACTGAACAGG + Intergenic
1190313990 X:49137766-49137788 CTTAGTTATCAGGACTAAACAGG + Intergenic