ID: 922797949

View in Genome Browser
Species Human (GRCh38)
Location 1:228350913-228350935
Sequence CGGGTACGGGGCGCCTTCGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 18}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922797949_922797961 7 Left 922797949 1:228350913-228350935 CCATCGAAGGCGCCCCGTACCCG 0: 1
1: 0
2: 0
3: 4
4: 18
Right 922797961 1:228350943-228350965 GGTGGGGCCCAGGCCTGCCCGGG 0: 1
1: 1
2: 12
3: 85
4: 618
922797949_922797973 24 Left 922797949 1:228350913-228350935 CCATCGAAGGCGCCCCGTACCCG 0: 1
1: 0
2: 0
3: 4
4: 18
Right 922797973 1:228350960-228350982 CCCGGGGATGGGGCATGAGGGGG 0: 1
1: 0
2: 3
3: 37
4: 409
922797949_922797959 -3 Left 922797949 1:228350913-228350935 CCATCGAAGGCGCCCCGTACCCG 0: 1
1: 0
2: 0
3: 4
4: 18
Right 922797959 1:228350933-228350955 CCGCAGATCAGGTGGGGCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 202
922797949_922797963 12 Left 922797949 1:228350913-228350935 CCATCGAAGGCGCCCCGTACCCG 0: 1
1: 0
2: 0
3: 4
4: 18
Right 922797963 1:228350948-228350970 GGCCCAGGCCTGCCCGGGGATGG 0: 1
1: 0
2: 14
3: 68
4: 526
922797949_922797956 -9 Left 922797949 1:228350913-228350935 CCATCGAAGGCGCCCCGTACCCG 0: 1
1: 0
2: 0
3: 4
4: 18
Right 922797956 1:228350927-228350949 CCGTACCCGCAGATCAGGTGGGG 0: 1
1: 0
2: 0
3: 1
4: 29
922797949_922797964 13 Left 922797949 1:228350913-228350935 CCATCGAAGGCGCCCCGTACCCG 0: 1
1: 0
2: 0
3: 4
4: 18
Right 922797964 1:228350949-228350971 GCCCAGGCCTGCCCGGGGATGGG 0: 1
1: 0
2: 1
3: 29
4: 348
922797949_922797954 -10 Left 922797949 1:228350913-228350935 CCATCGAAGGCGCCCCGTACCCG 0: 1
1: 0
2: 0
3: 4
4: 18
Right 922797954 1:228350926-228350948 CCCGTACCCGCAGATCAGGTGGG 0: 1
1: 0
2: 0
3: 0
4: 23
922797949_922797969 21 Left 922797949 1:228350913-228350935 CCATCGAAGGCGCCCCGTACCCG 0: 1
1: 0
2: 0
3: 4
4: 18
Right 922797969 1:228350957-228350979 CTGCCCGGGGATGGGGCATGAGG 0: 1
1: 0
2: 5
3: 75
4: 423
922797949_922797960 6 Left 922797949 1:228350913-228350935 CCATCGAAGGCGCCCCGTACCCG 0: 1
1: 0
2: 0
3: 4
4: 18
Right 922797960 1:228350942-228350964 AGGTGGGGCCCAGGCCTGCCCGG 0: 1
1: 1
2: 7
3: 75
4: 593
922797949_922797971 23 Left 922797949 1:228350913-228350935 CCATCGAAGGCGCCCCGTACCCG 0: 1
1: 0
2: 0
3: 4
4: 18
Right 922797971 1:228350959-228350981 GCCCGGGGATGGGGCATGAGGGG 0: 1
1: 1
2: 2
3: 33
4: 456
922797949_922797970 22 Left 922797949 1:228350913-228350935 CCATCGAAGGCGCCCCGTACCCG 0: 1
1: 0
2: 0
3: 4
4: 18
Right 922797970 1:228350958-228350980 TGCCCGGGGATGGGGCATGAGGG 0: 1
1: 0
2: 1
3: 29
4: 320
922797949_922797966 14 Left 922797949 1:228350913-228350935 CCATCGAAGGCGCCCCGTACCCG 0: 1
1: 0
2: 0
3: 4
4: 18
Right 922797966 1:228350950-228350972 CCCAGGCCTGCCCGGGGATGGGG 0: 1
1: 0
2: 4
3: 59
4: 650
922797949_922797975 28 Left 922797949 1:228350913-228350935 CCATCGAAGGCGCCCCGTACCCG 0: 1
1: 0
2: 0
3: 4
4: 18
Right 922797975 1:228350964-228350986 GGGATGGGGCATGAGGGGGTCGG 0: 1
1: 1
2: 8
3: 108
4: 920
922797949_922797962 8 Left 922797949 1:228350913-228350935 CCATCGAAGGCGCCCCGTACCCG 0: 1
1: 0
2: 0
3: 4
4: 18
Right 922797962 1:228350944-228350966 GTGGGGCCCAGGCCTGCCCGGGG 0: 1
1: 1
2: 12
3: 65
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922797949 Original CRISPR CGGGTACGGGGCGCCTTCGA TGG (reversed) Exonic
913532502 1:119742874-119742896 CTGGTAAGGGGCGCCTGCCAGGG - Exonic
922797949 1:228350913-228350935 CGGGTACGGGGCGCCTTCGATGG - Exonic
923299697 1:232629998-232630020 CGGGTCCGGGCCGCCTCCGCCGG - Intergenic
1084265593 11:68003824-68003846 CGGGTTCGGGGCGCGATCGCGGG - Intronic
1098893426 12:76031833-76031855 CGGGTCCGGGTCGCCTTCCAGGG - Exonic
1111940415 13:94601557-94601579 CGAGTCCGCGGGGCCTTCGAAGG - Intergenic
1116945308 14:50830777-50830799 CGGGGACGGGGCTGCTTCGGAGG - Intronic
1202905500 14_GL000194v1_random:69101-69123 CAGGTACTGGGCGCCATCGACGG + Intergenic
1133076370 16:3283752-3283774 TGGGTTCAGGGCGCCTTCGTAGG + Exonic
1158653608 18:59308832-59308854 TGGGTACAGGGACCCTTCGATGG - Intronic
1161730698 19:5958952-5958974 CGGGGTCGGGGGGCCTGCGAAGG - Intronic
1168646054 19:58059847-58059869 CGGGTACGCGGGGCCCTGGACGG + Intronic
928998576 2:37324308-37324330 CGGGAACGGATCGCCTCCGATGG + Intronic
1176624869 21:9083860-9083882 CAGGTACTGGGCGCCATCGACGG + Intergenic
954150817 3:48656236-48656258 CCGGCAGGCGGCGCCTTCGAGGG - Exonic
961495438 3:127287968-127287990 CTGGTAGGGGGCGCATTTGAGGG - Intergenic
999223586 5:150001177-150001199 CGGGTAAGTCCCGCCTTCGAGGG + Exonic
1002524151 5:179806372-179806394 CGGGGAAGGGGCGCCTGCGTCGG + Intronic
1028198659 7:87935157-87935179 CGGGTGCGGGGCGACCTCGGTGG + Exonic
1054356497 9:64067571-64067593 CAGGTACTGGGCGCCATCGGCGG + Intergenic
1203748034 Un_GL000218v1:54288-54310 CAGGTACTGGGCGCCATCGACGG + Intergenic
1203561691 Un_KI270744v1:63685-63707 CAGGTACTGGGCGCCATCGGCGG - Intergenic
1200047820 X:153411858-153411880 CTGGTACGGGGCGGCCCCGAGGG - Intergenic