ID: 922798302

View in Genome Browser
Species Human (GRCh38)
Location 1:228352361-228352383
Sequence TGAGCCACAGCACCTAGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4809
Summary {0: 1, 1: 4, 2: 78, 3: 986, 4: 3740}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922798302_922798305 10 Left 922798302 1:228352361-228352383 CCAAAGCTAGGTGCTGTGGCTCA 0: 1
1: 4
2: 78
3: 986
4: 3740
Right 922798305 1:228352394-228352416 CTCAACAATTTGGGAAGCCAAGG 0: 3
1: 84
2: 2006
3: 22748
4: 131041
922798302_922798303 0 Left 922798302 1:228352361-228352383 CCAAAGCTAGGTGCTGTGGCTCA 0: 1
1: 4
2: 78
3: 986
4: 3740
Right 922798303 1:228352384-228352406 CGTCAGTAATCTCAACAATTTGG 0: 1
1: 3
2: 72
3: 2075
4: 30135
922798302_922798306 14 Left 922798302 1:228352361-228352383 CCAAAGCTAGGTGCTGTGGCTCA 0: 1
1: 4
2: 78
3: 986
4: 3740
Right 922798306 1:228352398-228352420 ACAATTTGGGAAGCCAAGGCAGG 0: 9
1: 500
2: 10255
3: 87238
4: 208824
922798302_922798304 1 Left 922798302 1:228352361-228352383 CCAAAGCTAGGTGCTGTGGCTCA 0: 1
1: 4
2: 78
3: 986
4: 3740
Right 922798304 1:228352385-228352407 GTCAGTAATCTCAACAATTTGGG 0: 1
1: 3
2: 180
3: 4208
4: 53639

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922798302 Original CRISPR TGAGCCACAGCACCTAGCTT TGG (reversed) Intronic
Too many off-targets to display for this crispr