ID: 922798304

View in Genome Browser
Species Human (GRCh38)
Location 1:228352385-228352407
Sequence GTCAGTAATCTCAACAATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58031
Summary {0: 1, 1: 3, 2: 180, 3: 4208, 4: 53639}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922798302_922798304 1 Left 922798302 1:228352361-228352383 CCAAAGCTAGGTGCTGTGGCTCA 0: 1
1: 4
2: 78
3: 986
4: 3740
Right 922798304 1:228352385-228352407 GTCAGTAATCTCAACAATTTGGG 0: 1
1: 3
2: 180
3: 4208
4: 53639

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922798304 Original CRISPR GTCAGTAATCTCAACAATTT GGG Intronic
Too many off-targets to display for this crispr