ID: 922800347

View in Genome Browser
Species Human (GRCh38)
Location 1:228362148-228362170
Sequence GGTGAGAACCAGAGGAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 1, 2: 0, 3: 26, 4: 318}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922800347_922800354 11 Left 922800347 1:228362148-228362170 CCAAGCTTCCTCTGGTTCTCACC 0: 1
1: 1
2: 0
3: 26
4: 318
Right 922800354 1:228362182-228362204 CTGTGCCCAGGTTTGAGGAGAGG 0: 1
1: 0
2: 1
3: 36
4: 250
922800347_922800358 24 Left 922800347 1:228362148-228362170 CCAAGCTTCCTCTGGTTCTCACC 0: 1
1: 1
2: 0
3: 26
4: 318
Right 922800358 1:228362195-228362217 TGAGGAGAGGCCAGCCCTGGTGG 0: 1
1: 0
2: 7
3: 96
4: 748
922800347_922800359 25 Left 922800347 1:228362148-228362170 CCAAGCTTCCTCTGGTTCTCACC 0: 1
1: 1
2: 0
3: 26
4: 318
Right 922800359 1:228362196-228362218 GAGGAGAGGCCAGCCCTGGTGGG 0: 1
1: 0
2: 0
3: 42
4: 426
922800347_922800357 21 Left 922800347 1:228362148-228362170 CCAAGCTTCCTCTGGTTCTCACC 0: 1
1: 1
2: 0
3: 26
4: 318
Right 922800357 1:228362192-228362214 GTTTGAGGAGAGGCCAGCCCTGG 0: 1
1: 0
2: 1
3: 26
4: 258
922800347_922800361 27 Left 922800347 1:228362148-228362170 CCAAGCTTCCTCTGGTTCTCACC 0: 1
1: 1
2: 0
3: 26
4: 318
Right 922800361 1:228362198-228362220 GGAGAGGCCAGCCCTGGTGGGGG 0: 1
1: 0
2: 6
3: 75
4: 523
922800347_922800362 28 Left 922800347 1:228362148-228362170 CCAAGCTTCCTCTGGTTCTCACC 0: 1
1: 1
2: 0
3: 26
4: 318
Right 922800362 1:228362199-228362221 GAGAGGCCAGCCCTGGTGGGGGG 0: 1
1: 0
2: 3
3: 50
4: 567
922800347_922800353 6 Left 922800347 1:228362148-228362170 CCAAGCTTCCTCTGGTTCTCACC 0: 1
1: 1
2: 0
3: 26
4: 318
Right 922800353 1:228362177-228362199 CTAGGCTGTGCCCAGGTTTGAGG 0: 1
1: 0
2: 1
3: 27
4: 190
922800347_922800352 -1 Left 922800347 1:228362148-228362170 CCAAGCTTCCTCTGGTTCTCACC 0: 1
1: 1
2: 0
3: 26
4: 318
Right 922800352 1:228362170-228362192 CTTGGCACTAGGCTGTGCCCAGG 0: 1
1: 0
2: 1
3: 22
4: 185
922800347_922800360 26 Left 922800347 1:228362148-228362170 CCAAGCTTCCTCTGGTTCTCACC 0: 1
1: 1
2: 0
3: 26
4: 318
Right 922800360 1:228362197-228362219 AGGAGAGGCCAGCCCTGGTGGGG 0: 1
1: 0
2: 1
3: 63
4: 472

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922800347 Original CRISPR GGTGAGAACCAGAGGAAGCT TGG (reversed) Intronic
900693487 1:3995747-3995769 GGTGAGAGCCAGCGGAGGTTGGG - Intergenic
901453712 1:9351731-9351753 GGTGTGAACAAAAGGAAGTTGGG + Intronic
901605946 1:10459341-10459363 GGTGTGAAGCAGAGCAAGCCTGG - Exonic
901872256 1:12144998-12145020 GGTGAGGACCACAGGTATCTGGG + Intergenic
902584807 1:17432240-17432262 GCAGATAACCAGGGGAAGCTAGG - Intronic
903024756 1:20419391-20419413 GGTGAGAGACAGTGGAGGCTTGG + Intergenic
903449316 1:23442234-23442256 GGGGAGAGCCAGATGAAGCAAGG - Exonic
904796345 1:33059010-33059032 GGTGAGAACCACACAAAGGTGGG + Intronic
904876963 1:33662816-33662838 AGTGAGGGCCAGAGGAAGGTGGG + Intronic
904884614 1:33726668-33726690 GGTGACCACCACAGGGAGCTGGG + Exonic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906212307 1:44019008-44019030 GGTGAGAAACTGACAAAGCTAGG - Intronic
907290320 1:53408939-53408961 GGTGAGCCCATGAGGAAGCTAGG + Intergenic
907446557 1:54511731-54511753 GGTCAGAACTTCAGGAAGCTGGG - Intergenic
907559826 1:55378166-55378188 GGTGAGACCCAGAGGATATTTGG + Intergenic
908427096 1:64017790-64017812 GGTGAGCAACCGAGCAAGCTTGG + Intronic
908761390 1:67515447-67515469 TGTGAGTACCAGAGATAGCTTGG + Intergenic
911056905 1:93716671-93716693 GGTGACCACCATAGGAAACTTGG + Intronic
911662013 1:100511523-100511545 GGTAACACCCAGAGGAAGCTGGG - Intronic
913110474 1:115653243-115653265 GATGAGAAACAGAAGGAGCTCGG + Intronic
913110684 1:115654686-115654708 GATGAGAAACAGAAGGAGCTCGG - Intronic
913201305 1:116496926-116496948 GGTCAGGACAAGAGGAAGCAAGG - Intergenic
914972724 1:152325384-152325406 GATGAGTACGTGAGGAAGCTGGG - Intergenic
916311916 1:163407314-163407336 GGAGAGCAACAGAGGCAGCTGGG - Intergenic
917260441 1:173161270-173161292 GGTGAGATCCAGAGGAAACCAGG + Intergenic
918093977 1:181319344-181319366 GGTCAGAACCAGAGGAAAAGGGG + Intergenic
919539580 1:198830467-198830489 GGAGAAAACCAGTGGTAGCTGGG - Intergenic
919611058 1:199746171-199746193 GTTGGCAACCAGAGGTAGCTGGG - Intergenic
919860862 1:201738959-201738981 AGTGAGAACTGGAGGAAGCAAGG + Intronic
920699781 1:208209164-208209186 CATGAGAACCAGAAGAAGCCTGG + Intronic
922461876 1:225819504-225819526 GGGGAGAGCCACAGGAACCTGGG + Intronic
922800347 1:228362148-228362170 GGTGAGAACCAGAGGAAGCTTGG - Intronic
923305513 1:232684761-232684783 TGGGAGAAGCAGATGAAGCTTGG - Intergenic
923665273 1:235993448-235993470 GGTGAGGAGGAGAGGAAGCACGG + Intronic
924083222 1:240420911-240420933 GAAGGGAGCCAGAGGAAGCTGGG + Intronic
1062798059 10:358847-358869 GGGGAGGAGCAGAGGAAGCAGGG + Intronic
1065293393 10:24253103-24253125 GCTGAGACCCAGAGGAAGGAAGG + Intronic
1067194196 10:44101212-44101234 GGTGAAATCTGGAGGAAGCTAGG + Intergenic
1070811016 10:79298192-79298214 GGTGAGACCCAGATGAAGGGTGG + Intronic
1071511316 10:86264287-86264309 GTAGAGAACCAGAGGATGATAGG - Intronic
1071712540 10:88063770-88063792 GGTGAGCTCCAGAGGAATTTGGG + Intergenic
1073566194 10:104537654-104537676 GGTGGGTAGCAGAGGAAGCAAGG + Intergenic
1075928383 10:126271890-126271912 GGAGAGAGACAGAGGAAGCCAGG - Intronic
1076071692 10:127495527-127495549 GGTGAATACCAGAGGGAACTAGG - Intergenic
1077156262 11:1093068-1093090 GGTGAGAGCCCGAGGAAGCATGG - Intergenic
1077614071 11:3662443-3662465 GGAGTGGATCAGAGGAAGCTGGG - Intronic
1078422898 11:11226814-11226836 GGTGTGCAAGAGAGGAAGCTAGG - Intergenic
1078581122 11:12540422-12540444 TGTGAGGAGCAGAGGAAGCATGG - Intergenic
1081608679 11:44545180-44545202 GGGGGGAACCTGATGAAGCTGGG + Intergenic
1081649755 11:44815873-44815895 GGTGGGCACAAGAGGAGGCTGGG + Intronic
1081722959 11:45303563-45303585 AGTGGGAAGAAGAGGAAGCTGGG + Intergenic
1082837232 11:57660082-57660104 GGTCAGAGCCAGAGAAAGGTGGG + Exonic
1083490877 11:63014543-63014565 GGTGGGCAGCAGAGGAGGCTGGG - Intronic
1083857830 11:65401707-65401729 GGGGAGCAGCAGGGGAAGCTGGG - Intronic
1085047207 11:73360512-73360534 GATGAGGCCAAGAGGAAGCTGGG + Exonic
1085217216 11:74843481-74843503 GGTGAGAACCAGGATGAGCTTGG - Intronic
1085328028 11:75623512-75623534 GGTGAGCATCAGAGGAGGCAGGG - Intronic
1085743538 11:79096279-79096301 GCCGAGCACCAGAGGAAGCAGGG - Intronic
1086142233 11:83512049-83512071 GGAGGGAGCCAGGGGAAGCTGGG + Intronic
1086392758 11:86382277-86382299 GGTGAGAACAAATGGTAGCTTGG + Intronic
1088003677 11:104914249-104914271 GGTGGGTACCAGGGGAAGGTAGG + Intergenic
1088120323 11:106361355-106361377 ATTAAGAACCAGAGGAGGCTGGG - Intergenic
1088180378 11:107103097-107103119 AGTGAAAGCCAGTGGAAGCTAGG - Intergenic
1089343429 11:117775147-117775169 GGTGAGGAGCAGAGGTACCTCGG - Intronic
1089786515 11:120911185-120911207 GGTGAGAACCAAAAGTAGCTTGG + Intronic
1092085207 12:5751666-5751688 GGTGAGAGCAAAAGGAAACTTGG - Intronic
1093228326 12:16513277-16513299 GGAGAGAATCAGAGTAAGCAGGG - Intronic
1093726914 12:22523603-22523625 GGTGAGCTGCAGAGGAAGATTGG - Exonic
1093923361 12:24884322-24884344 GGTGGTTACCAGAGGAGGCTAGG + Intronic
1094161452 12:27395133-27395155 CCTGAGAACCAAAGGAATCTGGG + Intronic
1094837374 12:34328466-34328488 GGTGTGAACCAGGGGATGCCTGG + Intergenic
1096152473 12:49323303-49323325 GGAGAAAAGCGGAGGAAGCTGGG + Exonic
1097275122 12:57807838-57807860 GGAGAGAACCAGAGGGAGAAAGG - Intronic
1098196171 12:68004371-68004393 GGGAAGATCCAGAGGAAGCTTGG - Intergenic
1099347327 12:81518469-81518491 GGTGAGAACATGAGAAAGCGTGG - Intronic
1100240552 12:92706832-92706854 GGTGACCACCTGGGGAAGCTGGG + Exonic
1100399519 12:94216835-94216857 GGTGGGATGCAGAGGGAGCTGGG - Intronic
1102462734 12:113109989-113110011 GCTGAGAACTAGAGGACACTTGG + Intronic
1102778449 12:115541979-115542001 GGTGAGAACTAGGTGGAGCTTGG - Intergenic
1104010273 12:124925369-124925391 GGTGGGCACAAGAGGAAGCAGGG - Intergenic
1104111910 12:125712069-125712091 TGTGGCAACCAAAGGAAGCTAGG + Intergenic
1104765866 12:131329817-131329839 GGTGAGTACAAGAGGAAGTGTGG + Intergenic
1104813401 12:131632045-131632067 GGTGAGTACAAGAGGAAGTGTGG - Intergenic
1106755735 13:32821289-32821311 CTTGAGGACTAGAGGAAGCTGGG + Intergenic
1110275133 13:73634251-73634273 GGTGTGTCCCAGAGGAAGTTGGG + Intergenic
1110312177 13:74063065-74063087 GGTGCGGCACAGAGGAAGCTCGG - Intronic
1111872419 13:93849491-93849513 GGTGAGAGCTAGAGGGAGATGGG - Intronic
1111900794 13:94197306-94197328 GGTGAGAACTTGATGATGCTTGG - Intronic
1112379954 13:98879255-98879277 AGTGGGAACCAGGGGAAGCAGGG + Intronic
1112549117 13:100403500-100403522 GGTGAGAACCACAGTGAGCGGGG + Intronic
1115777993 14:36737301-36737323 GGAGAGAAGAAGAGGCAGCTGGG + Intronic
1121109030 14:91299939-91299961 GGCGAGAACCAGAGGCTGCGGGG - Exonic
1121112327 14:91320917-91320939 GGGGAGAGCCAGAGGAGGCGTGG - Intronic
1121163954 14:91774066-91774088 GTGAAGATCCAGAGGAAGCTAGG + Intronic
1121740951 14:96252120-96252142 GGTGAGGACCAGAAGGACCTGGG + Intronic
1122404384 14:101491276-101491298 TGTGGGAACCAGAGGAAGATGGG + Intergenic
1122859356 14:104575611-104575633 AGTGAGAACCATAGGCTGCTGGG - Intronic
1124154353 15:27212338-27212360 GGTGAAGAACTGAGGAAGCTGGG - Intronic
1125410993 15:39406003-39406025 CGTTAGAACCACAGGAAGGTAGG - Intergenic
1126131839 15:45349229-45349251 TATGAAAACCAGAGGAAGGTCGG + Intergenic
1126891946 15:53215908-53215930 GGTTAGAATCAGAGGAGGCTCGG - Intergenic
1127053455 15:55108563-55108585 AGTAAGAAACTGAGGAAGCTAGG + Intergenic
1128165950 15:65464866-65464888 GGTTAGAAACAGATAAAGCTGGG + Intronic
1128982583 15:72197923-72197945 GGAGAGAAGCTGGGGAAGCTGGG - Intergenic
1129115266 15:73362077-73362099 GGTGTGAACAGGAAGAAGCTGGG - Intronic
1129185262 15:73902277-73902299 GGTGTCAACAAGAGGATGCTTGG - Intergenic
1129258055 15:74345388-74345410 GGTGAGAGGCAGAGGGTGCTCGG - Intronic
1129672399 15:77614525-77614547 GGTGAGAGCCAGAGGATGGCGGG + Exonic
1130601770 15:85280257-85280279 GGCCAGAGCCAGAGGAAGGTGGG - Intergenic
1131179696 15:90231335-90231357 GGTGAGAACCAGGAGCAGCCCGG - Exonic
1132264887 15:100461092-100461114 TGTGAGAGCAACAGGAAGCTTGG + Intronic
1132712532 16:1275942-1275964 GGTGAGAACCAGAGGGACGTGGG - Intergenic
1133295260 16:4748839-4748861 GGTGAACCCCAGGGGAAGCTGGG - Exonic
1133437596 16:5793262-5793284 GGGGAGAAGCAGAGGCAGCCAGG - Intergenic
1135388616 16:22069012-22069034 AGTGAGAAGCAGAGGTAGCCTGG - Intronic
1136922445 16:34344087-34344109 GGTGAGAAAGAGAAGAGGCTGGG - Intergenic
1136982128 16:35067719-35067741 GGTGAGAAAGAGAAGAGGCTGGG + Intergenic
1137950436 16:52778721-52778743 GGTGACAACCACGGGATGCTCGG - Intergenic
1138533864 16:57649434-57649456 GGTGTGAACCAAAGGAGGCTGGG + Intronic
1138868046 16:60848105-60848127 TGGGAGAACCTGATGAAGCTGGG + Intergenic
1140426757 16:74867600-74867622 GTTTAGCACAAGAGGAAGCTGGG - Intergenic
1141024099 16:80527868-80527890 GCTGAGATCCAAAGGAGGCTCGG - Intergenic
1142325602 16:89412445-89412467 GTTGAGAAGAAGAGGAAGGTAGG - Intronic
1142915193 17:3130907-3130929 GGTGAGAAGAACAAGAAGCTTGG - Intergenic
1143125448 17:4638828-4638850 GGTGAGAGCAAGGGGAGGCTGGG - Exonic
1143403020 17:6657984-6658006 GGTGAGAGCAAGGGGAGGCTGGG + Intergenic
1146423111 17:32707969-32707991 AGTGAGATCCAGAGGAAACCAGG - Intronic
1147045027 17:37745413-37745435 GGTGAGAGCCAGAGGAAGCTGGG + Intergenic
1148958903 17:51376662-51376684 GGTGAGTATCTGAGGAAGCAAGG + Intergenic
1149538279 17:57449255-57449277 GATGAGACCAGGAGGAAGCTAGG - Intronic
1150282271 17:63935610-63935632 GGTGAGAAACAGAGACAACTTGG - Intergenic
1151928856 17:77218069-77218091 GGTGGAAGCCAGAGGCAGCTTGG + Intergenic
1152677977 17:81651346-81651368 GGAGGGAACCAGAGGAGGGTGGG + Intronic
1152885447 17:82846544-82846566 GCTGAGACCCAGGGGAAGCTTGG + Intronic
1155220734 18:23683253-23683275 GTCGAAAACCAGAGGAAACTAGG - Intergenic
1156246619 18:35305978-35306000 GGTGAGAACAAGACCAAGATTGG + Intergenic
1156376811 18:36521933-36521955 TGTGTGAACCAGATGAAGATGGG - Intronic
1156859952 18:41824315-41824337 AGGGATAACAAGAGGAAGCTAGG + Intergenic
1157123993 18:44937867-44937889 GGGGAGAAAGAGAGGAAGATTGG - Intronic
1157293718 18:46427252-46427274 GGTGGCAGCCAGAGGAAGGTGGG - Intronic
1158629239 18:59097718-59097740 GATGAGAACAAGCGGGAGCTTGG - Intergenic
1159050449 18:63416709-63416731 GGGGAGAACCACACGTAGCTAGG - Intronic
1159919709 18:74216422-74216444 GGTGGGAACCAGAGCAGGCCTGG + Intergenic
1160657209 19:279724-279746 AGTAAGGAGCAGAGGAAGCTCGG - Intergenic
1160716886 19:580782-580804 GGTGAGAAGCCAAGGAGGCTGGG + Exonic
1161080270 19:2307055-2307077 TGTGAGAACCAGAGCAACCCAGG - Intronic
1162029087 19:7909725-7909747 GGTGAGAACCAGTGGCAGGGAGG - Intronic
1163242936 19:16075622-16075644 GGTCAGAACCAGAGGGAGAAAGG + Intronic
1163687786 19:18721935-18721957 GGGCAGACCCAGAGGAGGCTGGG - Intronic
1163731577 19:18952696-18952718 CGTGAGAGACAGAGGAAGATGGG - Intergenic
1163790542 19:19303600-19303622 GGTGAGAATCAGAAAACGCTTGG + Intronic
1164813223 19:31174787-31174809 GATGAGAACCAGAAGGAGCCAGG + Intergenic
1165060237 19:33201560-33201582 GCTGAGAACCAGAGAGAACTTGG + Intronic
1165433585 19:35785205-35785227 GGGGAGAAGCAGCGGAAGCCAGG + Exonic
1166033796 19:40152741-40152763 GGTGACAACCAGAAGGAACTGGG + Intergenic
1166555941 19:43699892-43699914 GGTGAGAAACTCAGGAAGCAGGG + Intergenic
1166689746 19:44815218-44815240 GGTAGGAACCAGAGGAGCCTGGG - Intronic
1167119275 19:47507118-47507140 GGAGTGAAGCAGAGGCAGCTTGG - Intronic
1167478308 19:49713383-49713405 GGTCAGAGCCAGGGGAAGCTGGG - Intronic
926049880 2:9737777-9737799 GGGGAGTACCAGAGGAAGTGGGG - Intergenic
926784656 2:16508033-16508055 GGTGAAAGCCAGAGGAACCTGGG + Intergenic
927336389 2:21929569-21929591 GATTACAACCAGAGCAAGCTTGG + Intergenic
927718733 2:25369570-25369592 CGTCAGTACCAGAGGATGCTTGG + Intergenic
928421761 2:31142626-31142648 GGTGAGAAACAAAGAAAGTTTGG - Intronic
929085449 2:38163253-38163275 GGTGAGAAGCATGGGAAGCCAGG + Intergenic
929881054 2:45837701-45837723 GTTGAGAATCTGAGAAAGCTGGG - Intronic
931629326 2:64285072-64285094 AGAGAGAAACAGAGGAAGCAGGG - Intergenic
931716696 2:65034554-65034576 GATGAGGCCCAGAGGAACCTAGG + Intergenic
932021973 2:68096555-68096577 GGTGAGAATGAGAGAAAGATGGG - Intronic
932582730 2:73002842-73002864 AGTGAGAATCAGGGGAACCTGGG + Intronic
933214781 2:79617803-79617825 GGAAAGAACAAGAGGAGGCTGGG - Intronic
933379063 2:81519987-81520009 GGTGAGAGCCAATGGAAGCTTGG + Intergenic
935661586 2:105471255-105471277 CTAGAGAACCAGAGAAAGCTTGG - Intergenic
936041486 2:109153503-109153525 GGTCAAAAGCAGAGGAAGCATGG + Intronic
937061192 2:118981656-118981678 GGTAAGAACTACAGGAATCTGGG + Exonic
937339582 2:121082606-121082628 GCTGGGACCCACAGGAAGCTTGG + Intergenic
939542214 2:143508162-143508184 GGTGTGAACAAGAGGAAGTATGG - Intronic
941228894 2:162884188-162884210 GATGAGAGTCAGAGGAAGCTGGG + Intergenic
943275483 2:185862329-185862351 TGTGAGAACCAGACCAATCTAGG + Intergenic
943919375 2:193683230-193683252 GTTGAGAACCAGAACAAGCAAGG - Intergenic
944406144 2:199385839-199385861 GGTGACAAGCAGAGGAGGCTGGG - Intronic
944661453 2:201924887-201924909 GGTGAGAGCAACAGGGAGCTGGG - Intergenic
945768117 2:214005155-214005177 AGTGAGAAAAAGTGGAAGCTTGG - Intronic
946884104 2:224205759-224205781 GGTGAGAAGGAAAGGAAGATGGG - Intergenic
946951592 2:224881892-224881914 TGTGAGAAACAGATGCAGCTTGG - Intronic
1169193549 20:3671977-3671999 GGTGGGAGCCTGAGGAAGCATGG + Exonic
1170014581 20:11766331-11766353 GGTGAGAATGAGAGGAAGGCAGG - Intergenic
1170045001 20:12075542-12075564 TGTGGGACCCAGAGCAAGCTAGG - Intergenic
1170510873 20:17075510-17075532 GGTGACTACCACAGGAATCTCGG + Intergenic
1171997184 20:31740665-31740687 AGTGAGAATCAGAGCAAGATAGG + Intronic
1172151774 20:32795908-32795930 GGTGAGGAACAAGGGAAGCTGGG + Intronic
1172589086 20:36105080-36105102 GGTGGGAACCAGGGGAATATTGG + Intronic
1172863484 20:38076567-38076589 GCTGAGAAGCAGAGGCAGCAAGG - Intronic
1172988797 20:39016197-39016219 GAAGAGAAACAGAGGAAGCCAGG + Intronic
1173285677 20:41669860-41669882 GGTGAGAGACAGAGGAAGGAAGG + Intergenic
1173376910 20:42493826-42493848 GGAGAGAAAAAGAGGATGCTGGG - Intronic
1173504963 20:43579633-43579655 GGGGAGTACCAGTGGGAGCTTGG - Intronic
1173606918 20:44338008-44338030 GCTGACCAGCAGAGGAAGCTGGG + Intronic
1173985548 20:47258981-47259003 GGTGAGCACCAGGGGAACCGAGG - Intronic
1174126245 20:48309160-48309182 TGGGAGAACTAGGGGAAGCTGGG - Intergenic
1175853731 20:62107701-62107723 GGTGAGAACGGGAGCAAGGTTGG - Intergenic
1178728880 21:35080764-35080786 GGTGAGAGCCAGAGAAAGTAGGG + Intronic
1178808844 21:35862334-35862356 GGTGAGAAACCGAGGAGGGTAGG + Intronic
1181129859 22:20724783-20724805 GGTGAGATCCAGAGGCAGTGGGG - Intronic
1183038087 22:35155354-35155376 GGTTAGATCAAGGGGAAGCTGGG - Intergenic
1183382836 22:37498946-37498968 GGTGGAAACCAGAGGACTCTGGG + Intronic
1183859306 22:40657900-40657922 GGGGAGAACCAGATAAAGCTAGG - Intergenic
1185374860 22:50477827-50477849 TGTGAGAAGCAAAAGAAGCTAGG - Intergenic
950227718 3:11249550-11249572 GGTAAGAACCTTGGGAAGCTGGG + Intronic
950579045 3:13850880-13850902 GAGGAGAACCAGAAGAACCTGGG - Intronic
951867408 3:27323446-27323468 GGTGAGAACGGGAGGATTCTGGG + Intronic
953659406 3:44880613-44880635 GGTGAGGTCCTGAGGGAGCTAGG + Intronic
954249249 3:49355506-49355528 AGAGAGAACCAGAGGGAGGTGGG + Intergenic
954751092 3:52814099-52814121 GGTCAGAGACAGAGGAAGCCTGG + Intronic
954956214 3:54520344-54520366 TCTGAGAAGCAGATGAAGCTGGG + Intronic
955146436 3:56324783-56324805 GGTGAGAGCCAGAGGAAATGAGG - Intronic
957304376 3:78438053-78438075 TGTTAGTAACAGAGGAAGCTGGG + Intergenic
958039876 3:88214086-88214108 GGTGGGAATCCGAGGAAGCAAGG - Intergenic
958052515 3:88366367-88366389 ACTGAAAACCAGATGAAGCTGGG + Intergenic
959227125 3:103599971-103599993 TGAGAGAACCTGATGAAGCTGGG - Intergenic
959767400 3:110048034-110048056 GGTGGGACCCAGAGCAAGCATGG - Intergenic
960814366 3:121657987-121658009 GGTGAGAAGCAGGTGAACCTGGG - Intronic
960824380 3:121767612-121767634 GGTAAGAAACACAGGAAGATTGG + Intergenic
960842032 3:121969247-121969269 GATCAGCACCAGAGGAACCTAGG - Intergenic
962364030 3:134765552-134765574 GGAGAGAACCAGAGGAAGTGAGG + Intronic
963406138 3:144866474-144866496 GGTGAGGACCTCAGGAAGCAAGG - Intergenic
964307196 3:155354766-155354788 GTTCAGAACCAGAGGAGGCAGGG - Intergenic
966365002 3:179175810-179175832 GGTGAGAAACAGAGAATGATGGG - Intronic
966939250 3:184735089-184735111 GTTGGGGACCGGAGGAAGCTGGG - Intergenic
966963492 3:184966107-184966129 GGTGAGGACCTCAGGAAGCCAGG + Intronic
968207049 3:196812316-196812338 GGTGGAAACTAGATGAAGCTGGG + Intronic
968690941 4:1989875-1989897 GGTAAGAACCACATGAAGTTAGG + Intronic
968728090 4:2257462-2257484 GGTGACAGCCGGAGGCAGCTAGG - Intronic
972272117 4:37522039-37522061 GGTGAGACCCAATGGAATCTTGG - Intronic
973619896 4:52715745-52715767 GGAGAGAAGCAGAGGCAGTTAGG - Intergenic
975308451 4:72876513-72876535 GTTGAGAACCAAAGTAAACTAGG + Intergenic
978165967 4:105607155-105607177 GGTGTAAACTAGAGGAAGATTGG + Intronic
981766913 4:148261571-148261593 GGTGAGAGCCAGAGTAAGAAAGG + Intronic
982412308 4:155092548-155092570 GGTGAGAAAGAGAAGAATCTAGG + Intergenic
982554664 4:156843735-156843757 GGTGAGAACCAAAACCAGCTTGG + Intronic
984801042 4:183717540-183717562 TGTGAGAACCAGGGGAACCGAGG + Intergenic
987122404 5:14779362-14779384 GGTGGGAACTAGAGGACGTTGGG - Intronic
989074131 5:37544587-37544609 AGTGAGAACCAGAGGAACTTGGG + Intronic
990343585 5:54849399-54849421 GGTGAAGTCCAGAGGAAACTGGG - Intergenic
990646359 5:57848941-57848963 GGAGAGAAAGAGAGGAAGATAGG - Intergenic
991997201 5:72400014-72400036 GGTGAGAACCAGGGCAGCCTTGG + Intergenic
993665878 5:90695067-90695089 GGTAAGAAGCAGTGGTAGCTAGG + Intronic
996225253 5:120985203-120985225 AATGAGAACAAGAGGAAGGTGGG + Intergenic
996266218 5:121543924-121543946 GGAAAGAACCTGATGAAGCTCGG + Intergenic
996581599 5:125037661-125037683 GGTGAGGCCCAGAGGAAACCAGG - Intergenic
997232822 5:132256742-132256764 CGAGAGAACCAGAGGGAGGTTGG + Intronic
997453516 5:134002036-134002058 GTTGAGGACCAGCCGAAGCTTGG - Intronic
998203842 5:140145647-140145669 GGTGAGAACAAGAGGGAGATTGG + Intergenic
999541988 5:152584359-152584381 GATGATAAGCAGAGGAAGGTGGG + Intergenic
999865488 5:155696145-155696167 GCTGAGAACCACAGGAAGCAAGG - Intergenic
1000503523 5:162084070-162084092 GAAGAGAACAAGAGCAAGCTTGG - Intronic
1001679299 5:173544415-173544437 TTTGAGAACCACAGGCAGCTAGG - Intergenic
1001818227 5:174689246-174689268 GTTCAGAACCAAAGGAGGCTGGG - Intergenic
1002607186 5:180390358-180390380 GAGGAGAAACAGAAGAAGCTCGG - Intergenic
1003271019 6:4607981-4608003 TGTCAGAACCACAGGAAGCATGG - Intergenic
1003651019 6:7960266-7960288 GGTGAGAACCTGTGGAAGTTCGG - Intronic
1005138765 6:22602133-22602155 GGTGAGAACCAGATCATGCTGGG - Intergenic
1005753330 6:28903709-28903731 GGGCTGAACCAGAGGAAGCCAGG + Exonic
1006150054 6:31982300-31982322 GGAGAGAACAAGAGCAACCTGGG - Exonic
1006156355 6:32015038-32015060 GGAGAGAACAAGAGCAACCTGGG - Exonic
1006360201 6:33583422-33583444 TGTGAGAGCCCCAGGAAGCTTGG - Intergenic
1006828646 6:36955361-36955383 GGAGAGGACAAGAGGAAGCAGGG + Intronic
1007714017 6:43843571-43843593 GGTGAGGACGTGAAGAAGCTGGG - Intergenic
1008544838 6:52575861-52575883 GGGAAGAACTGGAGGAAGCTTGG - Intronic
1011007656 6:82665245-82665267 GAGGAAAACCAGATGAAGCTAGG + Intergenic
1013463489 6:110398164-110398186 GGTGATGACCAGAGGATGCTGGG - Intronic
1013711875 6:112910328-112910350 GGTCAGAGCCAGAGAAAGCCAGG + Intergenic
1013878932 6:114869903-114869925 GGTGGGAGCCAGAGGAAAGTGGG - Intergenic
1015476109 6:133660340-133660362 GCTGAGTCACAGAGGAAGCTGGG - Intergenic
1016086297 6:139919476-139919498 GGTGTGAGCCAGAGGAACATTGG + Intergenic
1017311249 6:152980379-152980401 GGTGGGAAACACAGGAAGCAAGG + Intronic
1017363455 6:153604251-153604273 GCTGAGAATGAGAGGAATCTAGG - Intergenic
1019918889 7:4150430-4150452 TCTGAGAGACAGAGGAAGCTCGG - Intronic
1020154185 7:5708959-5708981 GCTGAGAACAAGAGAAAGCTGGG - Intronic
1020482400 7:8678488-8678510 AGCAACAACCAGAGGAAGCTAGG - Intronic
1022107200 7:27205104-27205126 CGTTAGAAGCAGAGGGAGCTTGG + Intergenic
1022445832 7:30469944-30469966 GGGGAGAAACAGAGTAAGGTGGG - Intronic
1023358793 7:39395045-39395067 GATGAGAACAGGAGGTAGCTGGG - Intronic
1024698545 7:51882320-51882342 GGTGAGGACCACAGAAAGGTAGG + Intergenic
1027242077 7:76337489-76337511 GATGAAAATCAGAGGAAGCCAGG - Intronic
1028263021 7:88686968-88686990 CCTGGGAACCAGAGGAGGCTTGG - Intergenic
1028380796 7:90196312-90196334 GGTGAATAGCAGAGGAAGCTGGG - Intronic
1029382205 7:100221562-100221584 GGTGAGAACCAGAGTGGGTTGGG + Intronic
1029402362 7:100354012-100354034 GGTGAGAACCAGAGTGGGTTGGG + Intronic
1029539271 7:101173274-101173296 GGTGAGAAGGACAGGGAGCTCGG - Exonic
1032471533 7:132182534-132182556 GGTGAGGACCAGGGGAAGGATGG - Intronic
1032547353 7:132754975-132754997 GGTGACTACCTGAGAAAGCTGGG - Intergenic
1033601725 7:142893475-142893497 GGGGACAACCAGGGGAAGATTGG - Intergenic
1034384782 7:150731935-150731957 GGTGAGAGCTAGAAGAATCTTGG - Intronic
1034851708 7:154499945-154499967 GGTGACATCCAGAGGAAACCAGG + Intronic
1035453970 7:158997197-158997219 CGTGGGAACCCGAGGAGGCTGGG - Intergenic
1036943867 8:13075941-13075963 GCTTAGAATCAGAGGAAACTAGG + Intergenic
1037150468 8:15628933-15628955 GATGAGGGTCAGAGGAAGCTAGG + Intronic
1037504448 8:19516328-19516350 GGTAAGAATCAGACGGAGCTGGG - Intronic
1037761418 8:21744256-21744278 GTTGGGAAGCAGAGGAAGTTGGG - Intronic
1040298645 8:46176440-46176462 GGTGAGAAGCAGTGAATGCTGGG + Intergenic
1040706383 8:50133622-50133644 GATGGCCACCAGAGGAAGCTGGG - Intronic
1041652502 8:60314671-60314693 GGTCAGAACCAGAGTAAACGGGG - Intergenic
1046851781 8:118982724-118982746 ACTGACAACCAGAGGAAGTTGGG - Intergenic
1047303903 8:123637834-123637856 GGTTAGAACCAGCAGAAGCCAGG + Intergenic
1048855159 8:138680687-138680709 GGTAAGAAGCAGGGGAAGCTAGG - Intronic
1050253139 9:3767065-3767087 GCTGAGAACAACCGGAAGCTAGG + Intergenic
1052283287 9:26756584-26756606 GGAGAGAGCCAGGGGAGGCTGGG + Intergenic
1053002456 9:34584823-34584845 GGTCTGGACCAGAGGAGGCTGGG - Intronic
1053241325 9:36498129-36498151 GCTGAGAGACAGAGGAAGATTGG - Intergenic
1053515366 9:38725978-38726000 AGTGAGACTCAGAGGCAGCTGGG - Intergenic
1055376947 9:75658954-75658976 TGTTAGAACCAGAGCTAGCTAGG - Intergenic
1057501956 9:95603144-95603166 GTGGAGAACTGGAGGAAGCTGGG - Intergenic
1057878309 9:98774273-98774295 GGAGAGATCCAGAAGAAGCCTGG - Intronic
1060671777 9:125476100-125476122 GCAGGGAGCCAGAGGAAGCTAGG + Intronic
1060770709 9:126329863-126329885 GGTGAGAGCCAGAGCAGCCTGGG - Intronic
1061200505 9:129135803-129135825 GGTTGGAACCAGAAGAACCTAGG + Intronic
1061777645 9:132976350-132976372 AGTGAGAACATGAGGAAACTGGG + Intronic
1185539013 X:887290-887312 GCTGAGAATCAGATGAACCTGGG + Intergenic
1186501915 X:10058084-10058106 GCTGAGAAAGAGAGGAAGATGGG - Intronic
1187751059 X:22465489-22465511 GGAGAGGAACAGAGGAAGCAAGG - Intergenic
1187960533 X:24563020-24563042 GTTAAGAACCAGTGGTAGCTGGG - Intronic
1189235016 X:39480152-39480174 GGTGAGATCCCAAGGCAGCTTGG + Intergenic
1190069472 X:47267604-47267626 GGTCAGAACCAGAGGAAAGATGG - Intergenic
1190077358 X:47327464-47327486 GGTCAGAACCAGAGGAAAGATGG + Intergenic
1190502843 X:51096614-51096636 GGTGAGAAGCAGAGGGTGCCAGG + Intergenic
1190690431 X:52908950-52908972 TGTGAGAACCAGAGCATCCTTGG + Intergenic
1190695552 X:52946842-52946864 TGTGAGAACCAGAGCATCCTTGG - Intronic
1190737021 X:53262411-53262433 GATGAGGGCAAGAGGAAGCTAGG + Intronic
1191652935 X:63561052-63561074 CGTGAGAACCTGGGGACGCTAGG - Intergenic
1192465154 X:71349716-71349738 GATGATACCTAGAGGAAGCTGGG + Intergenic
1192473135 X:71416773-71416795 GATGATACCTAGAGGAAGCTGGG - Intronic
1192655525 X:72989321-72989343 GGAGAGAACAAGAGGAAGTGAGG + Intergenic
1193997466 X:88384243-88384265 CGTGAGACACAGAGGAAGATTGG - Intergenic
1194681073 X:96853526-96853548 TGTGAGAACCAGCAGAACCTAGG - Intronic
1194862072 X:99011836-99011858 GGTGAGACATAGAAGAAGCTGGG - Intergenic
1195097249 X:101514908-101514930 GGGTAGAACCTGATGAAGCTGGG - Intronic
1195709772 X:107764785-107764807 GGTGGGCACCAGAGGAGCCTGGG - Intronic
1195730750 X:107964579-107964601 GGCGAAAACCAGAGGAAGACAGG + Intergenic
1196397525 X:115281006-115281028 GCTGACAACCACAAGAAGCTAGG - Intergenic
1199628018 X:149758289-149758311 CGAGGGAAACAGAGGAAGCTGGG + Intergenic
1200228237 X:154431206-154431228 GGGAAGGGCCAGAGGAAGCTGGG + Intronic
1202169302 Y:22024097-22024119 GCAGAGAACCAGAGGAAGGAGGG - Intergenic
1202222059 Y:22562268-22562290 GCAGAGAACCAGAGGAAGGAGGG + Intergenic
1202321056 Y:23633399-23633421 GCAGAGAACCAGAGGAAGGAGGG - Intergenic
1202549711 Y:26036657-26036679 GCAGAGAACCAGAGGAAGGAGGG + Intergenic