ID: 922804776

View in Genome Browser
Species Human (GRCh38)
Location 1:228379610-228379632
Sequence CGACCCCTCTTGGCTAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 49}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922804768_922804776 18 Left 922804768 1:228379569-228379591 CCTCATACCTATGTCTAAGCATA 0: 1
1: 0
2: 0
3: 11
4: 110
Right 922804776 1:228379610-228379632 CGACCCCTCTTGGCTAAAATGGG 0: 1
1: 0
2: 1
3: 0
4: 49
922804770_922804776 11 Left 922804770 1:228379576-228379598 CCTATGTCTAAGCATAGATGGAG 0: 1
1: 0
2: 0
3: 7
4: 101
Right 922804776 1:228379610-228379632 CGACCCCTCTTGGCTAAAATGGG 0: 1
1: 0
2: 1
3: 0
4: 49
922804766_922804776 20 Left 922804766 1:228379567-228379589 CCCCTCATACCTATGTCTAAGCA 0: 1
1: 0
2: 0
3: 10
4: 105
Right 922804776 1:228379610-228379632 CGACCCCTCTTGGCTAAAATGGG 0: 1
1: 0
2: 1
3: 0
4: 49
922804765_922804776 25 Left 922804765 1:228379562-228379584 CCAGGCCCCTCATACCTATGTCT 0: 1
1: 0
2: 2
3: 12
4: 218
Right 922804776 1:228379610-228379632 CGACCCCTCTTGGCTAAAATGGG 0: 1
1: 0
2: 1
3: 0
4: 49
922804767_922804776 19 Left 922804767 1:228379568-228379590 CCCTCATACCTATGTCTAAGCAT 0: 1
1: 0
2: 1
3: 16
4: 121
Right 922804776 1:228379610-228379632 CGACCCCTCTTGGCTAAAATGGG 0: 1
1: 0
2: 1
3: 0
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922804776 Original CRISPR CGACCCCTCTTGGCTAAAAT GGG Intergenic
901023669 1:6267876-6267898 CGACTCCTCTTTTGTAAAATGGG + Intronic
911034556 1:93527191-93527213 CGAAACCTCTTGGCTACAAATGG + Intronic
913530560 1:119731500-119731522 CCAACCCTCTGGGCTAAAGTTGG - Intronic
916178138 1:162060088-162060110 TGTCCTCTATTGGCTAAAATAGG + Intergenic
922804776 1:228379610-228379632 CGACCCCTCTTGGCTAAAATGGG + Intergenic
1069894367 10:71671476-71671498 CGAACCCTCCTTCCTAAAATGGG + Intronic
1073937155 10:108647449-108647471 CGGCCTCTAATGGCTAAAATTGG - Intergenic
1080044779 11:27797524-27797546 CCACCGCGCTTGGCTGAAATAGG - Intergenic
1089048679 11:115526819-115526841 CAAGCCCTATTGGCTAAAACTGG - Intergenic
1089083875 11:115800435-115800457 AGACCCCTCTTGACTTCAATAGG - Intergenic
1091145247 11:133273707-133273729 GGAGCCCTCTTTCCTAAAATGGG + Intronic
1093070217 12:14700751-14700773 CTACACCTCTTGGCTACATTGGG - Intergenic
1098159737 12:67638610-67638632 CTACCCCTCATCTCTAAAATGGG + Intergenic
1100636468 12:96439246-96439268 CCACCACTCCTGGCTAAATTTGG - Intergenic
1119380995 14:74228070-74228092 CGACCCTTATTCTCTAAAATGGG + Intergenic
1141736140 16:85854893-85854915 TGTCTCCTCTTGGCTGAAATTGG - Intergenic
1148601455 17:48897337-48897359 TTGCCCCTCTTGGCTAAAGTGGG + Intergenic
1152212915 17:79012534-79012556 AGAGCCCTCTTGGTTAAAAATGG + Intergenic
1162344768 19:10112733-10112755 CGAGACCTCTTGGCCAACATGGG + Intronic
1163271910 19:16259611-16259633 CAACCCCTCTTCTGTAAAATGGG - Intergenic
1168589585 19:57621733-57621755 CAGACCCTCTTGGCTAAAAATGG - Exonic
932950267 2:76285028-76285050 TGATCCCTCTGGGCAAAAATAGG - Intergenic
942561429 2:177224059-177224081 CAACCCTTGTTGCCTAAAATAGG + Intergenic
1169641866 20:7761124-7761146 GGACCCCTCTTGGCTTCAGTAGG - Intergenic
1174659539 20:52199588-52199610 CCACCACACTTGGCCAAAATAGG - Intronic
1177323858 21:19557592-19557614 AGACTCCTCTTGGCTTAACTAGG - Intergenic
1183074833 22:35420222-35420244 AGACCCCTCTTGTCTGAATTTGG + Intronic
1183611138 22:38907155-38907177 GGATCCCTCTTGGCCAAGATGGG - Intergenic
949327933 3:2888204-2888226 GGACCCCTCTTGGCTAAGGGGGG + Intronic
952640388 3:35587284-35587306 CAACATCTCCTGGCTAAAATGGG - Intergenic
957676098 3:83366918-83366940 TGCTCCCTCTTAGCTAAAATAGG - Intergenic
960119857 3:113936849-113936871 CCACCACACCTGGCTAAAATTGG + Intronic
967076071 3:186003269-186003291 CGCCCCCTCATGGCAACAATAGG - Intergenic
972613983 4:40680658-40680680 CTTCCACTCTTGGCTATAATGGG - Intergenic
973992573 4:56424892-56424914 CCACCCCTCTGACCTAAAATAGG - Intronic
975190186 4:71451601-71451623 TGACCACTCTTATCTAAAATTGG - Intronic
989130753 5:38104566-38104588 AGACCCCTCTGGCCTGAAATGGG + Intergenic
989639044 5:43565433-43565455 AAATCCCTCTTGGCTAAAAATGG + Intergenic
990016005 5:51063660-51063682 AAAACCCTCTTGGCTAGAATTGG + Intergenic
996083976 5:119285210-119285232 CAACCCCTCTGGGCCATAATTGG + Intronic
998156352 5:139788972-139788994 CGCTCCCTCCTGGCTAACATGGG + Intergenic
1000185754 5:158856207-158856229 CGACACCTCTTGGCTTAAATTGG - Intronic
1001969956 5:175947552-175947574 CAACCCCTCTTGACTATAACTGG + Intronic
1002247481 5:177896212-177896234 CAACCCCTCTTGACTATAACTGG - Intergenic
1012127085 6:95443661-95443683 TGACCTCTTTTGGATAAAATGGG + Intergenic
1015370917 6:132451381-132451403 CCACCCCTCTTGGCTGGAAGTGG + Exonic
1020756574 7:12211138-12211160 CGACGCCTCTGGGCTCAAACAGG + Intergenic
1030910970 7:115248461-115248483 GGATTCCTCATGGCTAAAATTGG - Intergenic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1039404720 8:37302642-37302664 AGCCCCCTCTTGGCCAGAATGGG + Intergenic
1187680155 X:21759700-21759722 ACACCCCTCTTGGCTTAAACTGG - Intergenic