ID: 922804781

View in Genome Browser
Species Human (GRCh38)
Location 1:228379643-228379665
Sequence TCCTGGCCAGCTTAGATTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922804779_922804781 5 Left 922804779 1:228379615-228379637 CCTCTTGGCTAAAATGGGTCATG 0: 1
1: 0
2: 0
3: 12
4: 134
Right 922804781 1:228379643-228379665 TCCTGGCCAGCTTAGATTTATGG 0: 1
1: 0
2: 0
3: 6
4: 132
922804774_922804781 11 Left 922804774 1:228379609-228379631 CCGACCCCTCTTGGCTAAAATGG 0: 1
1: 0
2: 1
3: 9
4: 115
Right 922804781 1:228379643-228379665 TCCTGGCCAGCTTAGATTTATGG 0: 1
1: 0
2: 0
3: 6
4: 132
922804778_922804781 6 Left 922804778 1:228379614-228379636 CCCTCTTGGCTAAAATGGGTCAT 0: 1
1: 0
2: 3
3: 13
4: 169
Right 922804781 1:228379643-228379665 TCCTGGCCAGCTTAGATTTATGG 0: 1
1: 0
2: 0
3: 6
4: 132
922804777_922804781 7 Left 922804777 1:228379613-228379635 CCCCTCTTGGCTAAAATGGGTCA 0: 1
1: 0
2: 3
3: 44
4: 274
Right 922804781 1:228379643-228379665 TCCTGGCCAGCTTAGATTTATGG 0: 1
1: 0
2: 0
3: 6
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922804781 Original CRISPR TCCTGGCCAGCTTAGATTTA TGG Intergenic
901313100 1:8284827-8284849 TCCTGCCCAGCCTAGAGTTGTGG + Intergenic
902270192 1:15298662-15298684 ACAGGGCCAGCCTAGATTTAGGG + Intronic
907576806 1:55534039-55534061 TCATGGCCAGATGAGATTTTAGG - Intergenic
911865391 1:103012897-103012919 TCCTGACCAGTTTTGTTTTATGG - Intronic
913697669 1:121343470-121343492 TCCTACCCAGGTTAGATGTAAGG + Intronic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
918189998 1:182164562-182164584 CTTTGGCCAGCTCAGATTTAGGG - Intergenic
920130834 1:203730626-203730648 TCCTGGGAGGCTGAGATTTATGG + Intronic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
920853749 1:209647126-209647148 TCTTGGCCAGCTTTGCCTTATGG - Intronic
922224397 1:223632779-223632801 TCCTGGCCACCTTCGAGCTAGGG + Intronic
922804781 1:228379643-228379665 TCCTGGCCAGCTTAGATTTATGG + Intergenic
1063917308 10:10896526-10896548 TACTGGCCATATTGGATTTAGGG - Intergenic
1068323297 10:55449351-55449373 TTCTGTCCAGCTTAGGTTTCTGG - Intronic
1069209885 10:65742760-65742782 TCATGGGCAGCTTAGGTTAATGG + Intergenic
1069546289 10:69331299-69331321 TCCTTCCCATCTTAGGTTTATGG - Intronic
1069736944 10:70662704-70662726 TACTGGCCAGATGAGATGTATGG + Intergenic
1071734501 10:88283124-88283146 TCCTGGCCAGCTGAATTTTATGG + Intronic
1073562776 10:104511092-104511114 ACCAGACCAGCTCAGATTTAAGG + Intergenic
1076477615 10:130763558-130763580 TCCTGGCAAGCTCAGATCTGGGG - Intergenic
1079123147 11:17699307-17699329 TCCTGCCTGGCTTAGATTTGGGG - Intergenic
1080483978 11:32685289-32685311 TCCTGCCCAGCTTAAATTCTGGG + Intronic
1081685216 11:45037704-45037726 CACTGGCTAGCTTAGGTTTAAGG - Intergenic
1086133904 11:83427782-83427804 ACAAGGCCAGCTTAGATTTTAGG + Intergenic
1087595754 11:100252961-100252983 CACAGGCCAGCTCAGATTTAAGG + Intronic
1087721407 11:101669922-101669944 TTCTGGCCATCTTAAATTTGAGG - Intronic
1089476771 11:118770147-118770169 TCCCGAGCAGCTTAGATTAACGG + Intronic
1090476720 11:127028798-127028820 TCCTGGCGCGCTTAAATTCAAGG - Intergenic
1091192011 11:133703946-133703968 ACCTGGGCAGCCTAGATTCAGGG + Intergenic
1092101338 12:5886097-5886119 GTCTGGGAAGCTTAGATTTATGG - Intronic
1093826941 12:23703822-23703844 TCCTGAGAAGCTTAGATTTATGG - Intronic
1097695799 12:62773807-62773829 TCCTGGGAAGCTTAGATTTCGGG + Intronic
1098306509 12:69108045-69108067 TGCTGGCTAGCTTTGATGTATGG - Intergenic
1099815965 12:87648107-87648129 ACTAGGCCAGCCTAGATTTACGG + Intergenic
1101923878 12:108955401-108955423 TCCCTGCCAGCCCAGATTTATGG + Intronic
1105273252 13:18897819-18897841 GCCTGGCCAGCTTAACTCTAAGG - Intergenic
1106002666 13:25738723-25738745 TCCTTGCCAGCTTTTATTTCAGG + Intronic
1107539672 13:41376164-41376186 TCCTGGGCAGCTTGGATTACAGG - Exonic
1108023338 13:46152028-46152050 TTCTAGCCTGCATAGATTTAAGG + Intronic
1108356910 13:49636469-49636491 TCCTGGACAGCTGGGATCTAAGG - Intergenic
1111507738 13:89216018-89216040 TCCTGGACAGCTGGGATTAAAGG - Intergenic
1118417078 14:65551755-65551777 TCCTAGCCTGCTTATATTTTTGG + Intronic
1118790865 14:69091453-69091475 TCGTGGCCAGCCTTGGTTTATGG + Intronic
1125579286 15:40774226-40774248 TCCAGGCCAGCTTAGAGCCAAGG - Intronic
1125607821 15:40952331-40952353 TCCTGGCCAGTTTAGAGAGAAGG + Intergenic
1126875565 15:53037738-53037760 GCTTGGCCATCTTGGATTTAAGG + Intergenic
1133338858 16:5023807-5023829 ACCAGGCCAGCTCAGATTCAGGG - Intergenic
1134198958 16:12181802-12181824 TCCTTGCCTGCTTATATTTTGGG + Intronic
1135358659 16:21792293-21792315 CCATGGCCAGCCTAGATTCAAGG + Intergenic
1135457215 16:22608729-22608751 CCATGGCCAGCCTAGATTCAAGG + Intergenic
1136512006 16:30743852-30743874 TCCTGGCCAGCTTTGCTGTCTGG + Intronic
1140632204 16:76866863-76866885 TTTTTGCCAACTTAGATTTATGG - Intergenic
1140819606 16:78650781-78650803 TGCAGGCCAGCTGAGATTTGTGG - Intronic
1142617568 17:1145407-1145429 TCCTGGGCTGATTTGATTTAAGG + Intronic
1144353464 17:14422044-14422066 ACCTGTCCAGGTTAGATTTCAGG + Intergenic
1146509173 17:33430946-33430968 TCCTCACCTGCTTATATTTAGGG - Intronic
1153179965 18:2421973-2421995 TGGTGGCCAGCTTAGAATTCTGG - Intergenic
1155714577 18:28925686-28925708 TCCTTGCCACCATGGATTTAAGG + Intergenic
1160246184 18:77161986-77162008 TCCTGGTCACCTCTGATTTAAGG - Intergenic
1162561689 19:11421189-11421211 TCCTCGCCAGCTTAGAGGGAAGG - Exonic
1165992041 19:39821525-39821547 TCAGGGCCAGCTCAGATATAAGG + Intergenic
1166157857 19:40928237-40928259 TCCTGGTCAGCTTTGCCTTAAGG + Intergenic
1166188659 19:41160337-41160359 TCCTGGTCACCTTAGATTGATGG - Intergenic
1167687202 19:50963732-50963754 TTCTGGACAGCTTGGATGTAGGG - Intronic
925600451 2:5603695-5603717 ACATGGCAAGCTCAGATTTAAGG - Intergenic
932161445 2:69463943-69463965 ACCTGGCCAGCTTTATTTTAAGG + Intronic
933323019 2:80800846-80800868 TCCAGGCCAGCCCAGATTCAAGG + Intergenic
935880837 2:107563529-107563551 TCATTGTCAGCTTTGATTTATGG - Intergenic
941553993 2:166952847-166952869 TCATGGCCAGTGTAGATTGATGG + Intronic
945005895 2:205405580-205405602 TTCTTGCAAGCTTAGATTGATGG - Intronic
945265251 2:207884560-207884582 CCCTGTCCAGCTCAGAGTTATGG + Intronic
945564369 2:211378329-211378351 TCCTGGCCAGGTGACATTTTGGG - Exonic
945849908 2:214992964-214992986 TCCTGGAAAACTTAGGTTTAAGG - Intronic
1169292688 20:4366176-4366198 TCCAGGCCAGCCCAGATTCAAGG - Intergenic
1173601231 20:44296797-44296819 TCCTGGGCTGCTTAGTTTTGGGG - Intergenic
1175136354 20:56827334-56827356 ACCTGGCCAGCTTTGCTTTGGGG - Intergenic
1176809516 21:13522996-13523018 GCCTGGCCAGCTTAACTCTAAGG + Intergenic
949953393 3:9248014-9248036 GCCTGGCTAGCGTGGATTTAGGG + Intronic
950573021 3:13813698-13813720 TCCAGGCCAGCCCAGATTCAAGG - Intergenic
951226326 3:20125390-20125412 TCCTCTCCAGCTGAGCTTTAAGG - Intronic
951682284 3:25307261-25307283 TCCTGGGCAGCTGAGATTACAGG - Intronic
954419900 3:50413217-50413239 TCCTGGCCAGCTCAGGATTCAGG - Intronic
957377752 3:79380747-79380769 ACAAGGCCAGCCTAGATTTAAGG - Intronic
958114541 3:89198470-89198492 TCCTGAGGAGCCTAGATTTAAGG - Intronic
959916491 3:111822107-111822129 ACCTGGCCTGCTTTTATTTATGG - Intronic
966540143 3:181080093-181080115 TCCTGGAGACTTTAGATTTAAGG + Intergenic
966877049 3:184328428-184328450 TCCTGGTCAGCATAACTTTAGGG + Intronic
968288798 3:197523461-197523483 TCCTGACCTGCTCAGATTAATGG + Intronic
969280569 4:6167864-6167886 TCCTAGCCAGCTCTGATTTCTGG - Intronic
971165748 4:24181807-24181829 TACTGGCCAACTTAGACTTCAGG - Intergenic
971460897 4:26895086-26895108 TCCTGGATAGCTGAGATTTCAGG - Intronic
971492900 4:27232860-27232882 TCCTGGCCATTTATGATTTATGG - Intergenic
978105398 4:104896130-104896152 TTCTGGCCATGTTAAATTTACGG + Intergenic
979181543 4:117734914-117734936 TCCTGAGCAGCTGAGATTTCAGG - Intergenic
979439899 4:120739254-120739276 TTGTGCCCAGCTTAGATTCAAGG + Intronic
979567545 4:122172135-122172157 CCCAGGGCAGCTTAGATTGATGG - Intronic
979840372 4:125432067-125432089 TACTGGCCAGCTTAAGTTTGTGG - Intronic
982220266 4:153118589-153118611 TCCTGGGCAGCTGAGATTACAGG + Intergenic
990813839 5:59759916-59759938 TTCTGCCCTGCTTAGCTTTAAGG - Intronic
990856138 5:60268547-60268569 TCCTGGACAGCCTAGTTTCAAGG + Intronic
992593643 5:78323492-78323514 TGCTAGCCAGCTTAGATCAATGG + Intergenic
994449101 5:99917973-99917995 TCCTGACTAGCTGAGATTTCAGG + Intergenic
994767163 5:103933245-103933267 TACTGGCCAGCTTGGCTTTCAGG - Intergenic
994822228 5:104668304-104668326 TCCTGCCCAGCTTGCATATAGGG - Intergenic
995910612 5:117182583-117182605 CCATGCCCAGCTTAGATTTCTGG - Intergenic
999932343 5:156447205-156447227 ACCTTCCCAGCTCAGATTTAAGG - Intronic
1000866756 5:166523692-166523714 TCATGGCCAACGTAGATTTTTGG - Intergenic
1002292266 5:178208041-178208063 TCCTGGCCAGCTTAAATCCAGGG + Intronic
1005906465 6:30265225-30265247 TCCAGATCAGCTTAGACTTAAGG - Intergenic
1007351875 6:41279414-41279436 ACCTGGACAGCTTACACTTAAGG + Intronic
1010573608 6:77507165-77507187 TCCTTCCCAGCTTAGGCTTAGGG + Intergenic
1012858113 6:104527273-104527295 CCATGGCCAGATCAGATTTAGGG - Intergenic
1012958090 6:105592461-105592483 TCTTGGCCAGATGAGTTTTAGGG - Intergenic
1016009791 6:139127328-139127350 ACAAGGCCAGGTTAGATTTAAGG + Intergenic
1017062547 6:150498857-150498879 TTCTGGCCACATTAGTTTTATGG - Intergenic
1022204916 7:28154233-28154255 TGCTGGACAGCTTAGATTATGGG - Intronic
1023141296 7:37104999-37105021 TCCTTGCCATTTTATATTTATGG - Intronic
1026381306 7:69802218-69802240 TTCTTGCCAACTTAGTTTTATGG + Intronic
1026587101 7:71664805-71664827 CCATGGGCAGCTTAGGTTTATGG + Intronic
1028386833 7:90264556-90264578 TACTGGTGAGCTTAGATCTATGG + Intronic
1028762186 7:94509376-94509398 TGCTGGCCAGATTGGATTGATGG - Intronic
1032110866 7:129074223-129074245 TGCTGGGCAGCTTGGATGTAGGG + Intergenic
1032925147 7:136595854-136595876 TCCTTGCCCTCTTAGGTTTAAGG - Intergenic
1035848840 8:2894004-2894026 TCCTGGCTAGCTCAGATGTGGGG - Intergenic
1038104801 8:24420522-24420544 TCATGGTCAGTGTAGATTTAAGG + Intergenic
1039573462 8:38605023-38605045 ACCTGGCCAGCTTAGACGTAAGG - Intergenic
1042762127 8:72282285-72282307 CCCTTCCCAGCTTAGGTTTAGGG - Intergenic
1046180676 8:110643175-110643197 TCTTGTTCAGCTTAGATATATGG - Intergenic
1048355458 8:133650294-133650316 TCCTGGCCAGCTTACCTGCAGGG + Intergenic
1056951264 9:91042615-91042637 CCCCGGCCAGCCTGGATTTAAGG + Intergenic
1056951346 9:91042965-91042987 CCCCGGCCAGCCTGGATTTAAGG - Intergenic
1203777782 EBV:83337-83359 TACTCGCCAGCCTAGATTTGTGG + Intergenic
1186715477 X:12246775-12246797 TCCTGGACACCTTAAAATTAAGG + Intronic
1187679923 X:21757644-21757666 TCCTGGCCAGCACAGCTTCAAGG + Intronic
1188810704 X:34651165-34651187 ATATGGCCAGCTTGGATTTAAGG - Intronic
1193560249 X:83009368-83009390 CCCTTGCCAGCTTAGGCTTAAGG + Intergenic
1197679503 X:129367178-129367200 ACATGGCCAGCTCAGATTCAAGG - Intergenic
1197985170 X:132259104-132259126 TCCTGGCCTGCTAAGTTTTTGGG - Intergenic
1201473906 Y:14360704-14360726 TCCTGGCAAGTTTTGTTTTATGG - Intergenic