ID: 922806194

View in Genome Browser
Species Human (GRCh38)
Location 1:228391318-228391340
Sequence CAGGGAAAGCACAGGGATCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 7, 3: 47, 4: 357}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922806186_922806194 2 Left 922806186 1:228391293-228391315 CCGGGCTGGGGAGGGCAGGGTAG 0: 1
1: 0
2: 6
3: 71
4: 717
Right 922806194 1:228391318-228391340 CAGGGAAAGCACAGGGATCCGGG 0: 1
1: 0
2: 7
3: 47
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922806194 Original CRISPR CAGGGAAAGCACAGGGATCC GGG Intergenic
900558237 1:3290682-3290704 CAGGGAAACAACAGGGCTCCAGG + Intronic
900614107 1:3556751-3556773 CAGTGAAAACACAAGGATGCAGG + Intronic
900750914 1:4396854-4396876 CAGGAACAGGCCAGGGATCCAGG + Intergenic
900992832 1:6105877-6105899 CAGGGGCAGGACAGGGCTCCAGG + Intronic
901051163 1:6426498-6426520 CTGGGCAAGCCCAAGGATCCAGG - Intronic
901510969 1:9717889-9717911 CAGGTTCAGCCCAGGGATCCGGG + Intronic
902452513 1:16506188-16506210 CAGGCAGAGCTCAGGGATCTAGG - Intergenic
902472569 1:16658862-16658884 CAGGCAGAGCTCAGGGATCTAGG - Intergenic
902486236 1:16748581-16748603 CAGGCAGAGCTCAGGGATCTAGG + Intronic
903123884 1:21234832-21234854 CAGGGACAGGACATGGATCCTGG + Intronic
903559321 1:24216135-24216157 GAGGGAAAGAAGAGGAATCCAGG + Intergenic
903625014 1:24724420-24724442 CAGTGATGGCACAGGGACCCAGG + Intergenic
904955023 1:34275879-34275901 CAGGCAGAGCACAGGACTCCTGG + Intergenic
905033360 1:34902250-34902272 CAGGGACAGCATAGGGTTCAGGG + Intronic
905248574 1:36631428-36631450 CAGAGAAAGCAAAGGGATGTAGG - Intergenic
906145691 1:43558780-43558802 GAGGGAAAGGCCAGGAATCCAGG - Intronic
907265959 1:53261434-53261456 GAGGGAAAGCAAAGGGATGATGG - Intronic
907850290 1:58249359-58249381 CAGTGAAAGCTCAGAGAGCCGGG + Intronic
909392715 1:75135130-75135152 CCCGGCAAGCCCAGGGATCCCGG - Intronic
910553344 1:88501262-88501284 CAGGGAAGGAACTGGGGTCCTGG + Intergenic
910665673 1:89723717-89723739 CAGGGAGTGAACAGGGCTCCTGG + Intronic
912493426 1:110075833-110075855 CTGGGAGAGCACAGGGGGCCTGG + Intergenic
912871406 1:113310479-113310501 GAGGGAGAGCACAGGGATTGTGG + Intergenic
912950636 1:114118121-114118143 CTGGGAAATCTCTGGGATCCTGG - Intronic
913115420 1:115692201-115692223 CAGGTAAAGCACAGGGAGAGAGG + Exonic
914910936 1:151786130-151786152 CAGGGAAAGCACAGTCAATCTGG + Intronic
915341598 1:155179535-155179557 AAGGGAAAGCAGCGGGAGCCGGG - Intronic
915367656 1:155324604-155324626 GAGGGAGGGCACAGGGAACCGGG + Intronic
917798932 1:178552917-178552939 CAGGGAGAGAACAGGGAGCAAGG + Intergenic
918059958 1:181052507-181052529 CAGGGTAAGGACGGGGATCGTGG + Exonic
918177819 1:182060780-182060802 CAGGGACAGCAAAGGGATGCTGG + Intronic
918200302 1:182260074-182260096 CAGGGAAAGAACTGGGATGTTGG - Intergenic
919161453 1:193835806-193835828 CAGGAGAAGCACTTGGATCCGGG + Intergenic
919684647 1:200472378-200472400 CAGGTAAAGCACATGGAACCAGG + Intergenic
920540948 1:206777570-206777592 GAGGGAAGGTTCAGGGATCCGGG + Intergenic
920832959 1:209481787-209481809 CAGGGAGAGGACAGTGAACCAGG - Intergenic
921164793 1:212499288-212499310 CAGGGAAATCACTCGGACCCGGG - Intergenic
921378934 1:214504423-214504445 CAGGAAGAGCACAGGCTTCCAGG - Intronic
922694828 1:227724662-227724684 AAGAGAAAGCCCTGGGATCCGGG - Intergenic
922806194 1:228391318-228391340 CAGGGAAAGCACAGGGATCCGGG + Intergenic
923634181 1:235679206-235679228 AAGGGAGGGCCCAGGGATCCAGG - Intronic
924143011 1:241045856-241045878 CAGGGAAGGCAAAGGGGCCCTGG + Intronic
924759261 1:246968856-246968878 CAGCTAAAGCACAGGGAACAGGG + Intronic
1063957795 10:11282316-11282338 CAGGGAGAGGACAGGCACCCAGG + Intronic
1064485341 10:15782949-15782971 GAGGGAAATCACTGGGAGCCAGG - Intronic
1065160907 10:22920487-22920509 TAGGGGAAGCACAGGGAAACAGG - Intergenic
1065305477 10:24364588-24364610 CAGGGAAGGCCCCGGGATGCTGG - Intronic
1066550525 10:36551676-36551698 CAGGCAAAGCACAGGGACCTTGG + Intergenic
1067296416 10:44977545-44977567 CAGGGAATGCCCAGGCATCCTGG + Exonic
1069896975 10:71685993-71686015 GATGGAAACCACAGGGCTCCAGG + Intronic
1070662419 10:78316787-78316809 CAGGGCAGGCAGAGGGAACCAGG + Intergenic
1070783180 10:79149133-79149155 TAGGGACAGAGCAGGGATCCAGG - Intronic
1071154551 10:82673888-82673910 GAGGGAAAGAACATAGATCCAGG + Intronic
1071370712 10:84948759-84948781 CAGCGAGAACACAGGGACCCAGG - Intergenic
1071464999 10:85931694-85931716 AAGGGATACCAAAGGGATCCAGG - Intronic
1072711045 10:97715613-97715635 CCGGGACAGCACAGGGATGCTGG - Exonic
1072892333 10:99335003-99335025 CAGGGAAAGAACAGGCTTTCGGG - Intronic
1072946493 10:99815140-99815162 CAGGGAGAACACATGGATACAGG - Intronic
1073422910 10:103438830-103438852 CAGGGAAGGCACTTGGGTCCGGG - Intronic
1073479218 10:103775664-103775686 CAGAGAAAGTGCTGGGATCCGGG + Intronic
1073778226 10:106809441-106809463 CAGGGCTAGCAGGGGGATCCTGG - Intronic
1074116308 10:110459770-110459792 CAGGGAATGCACAGGGTTGCCGG + Intergenic
1074293003 10:112155085-112155107 CAGAGAAAGCACAGGCCTCGAGG + Intronic
1074298003 10:112209015-112209037 CAGGGCAAGGACAGGGATTGGGG + Intronic
1075582854 10:123635096-123635118 CAGAGAAAGCCCAGGGTTCAAGG - Intergenic
1075830648 10:125408061-125408083 AAGGGAAAGCACAGTGATTGTGG - Intergenic
1076692882 10:132232738-132232760 TAGGAAAAGCCCAGGGCTCCGGG - Intronic
1076692897 10:132232794-132232816 TAGGAAAAGCCCAGGGCTCCGGG - Intronic
1077335371 11:2001137-2001159 CAGGCAAACCACAGGTAGCCGGG + Intergenic
1077350717 11:2091966-2091988 CAGGGAGAGGACAGAGATCCCGG - Intergenic
1079373863 11:19874346-19874368 AAGAGAAAGAACAGGGCTCCAGG + Intronic
1080039031 11:27739458-27739480 CAGGTGATGCACAGGGGTCCAGG + Intergenic
1080459237 11:32438929-32438951 CTGGCAAAGCGCAGGCATCCCGG + Intergenic
1080589030 11:33705372-33705394 CAGGGCAACTTCAGGGATCCAGG + Intronic
1081245652 11:40763652-40763674 AAGGGAAAGCACAGTGATTGTGG + Intronic
1081574339 11:44309889-44309911 CCGCCAAAGCACAGGGATTCGGG - Exonic
1081733573 11:45388216-45388238 CAGTGAGAGCACACAGATCCAGG - Intergenic
1083375229 11:62214809-62214831 CAAGGCAAGGGCAGGGATCCAGG + Intergenic
1083430086 11:62609707-62609729 GAGAGAAAGCACAGGGATTGGGG + Intronic
1083676439 11:64328149-64328171 CAGGAAAGGGACAGGGAACCAGG - Intergenic
1083676671 11:64329734-64329756 CAGGGCAGGGACAGGGAGCCAGG + Intergenic
1083934283 11:65862276-65862298 CAGGGTGAGCACAGGGATCAGGG + Exonic
1084083478 11:66843840-66843862 GAGGGAACTCACAGGCATCCAGG + Exonic
1084148219 11:67276062-67276084 CATGGCAAGCACAGAGAACCTGG + Intronic
1084501925 11:69540161-69540183 CAGGGAAAGGACAAAGACCCTGG + Intergenic
1084584637 11:70050502-70050524 AAGGAAAAGCACAGGGAGCGGGG - Intergenic
1085562662 11:77486631-77486653 GAGGGAAAGCACAGTGATTGTGG + Intergenic
1089051772 11:115551813-115551835 TAAGGAAAGCACTGGGAACCAGG + Intergenic
1089777995 11:120852487-120852509 CAGAGAAAGGACAGAGTTCCTGG + Intronic
1090350258 11:126103584-126103606 CCAGGCAAGCACAGGGTTCCGGG + Intergenic
1202818354 11_KI270721v1_random:56319-56341 CAGGCAAACCACAGGTAGCCGGG + Intergenic
1091379460 12:46593-46615 CAATGAAAGCACATGGATACAGG - Intergenic
1091534362 12:1391591-1391613 CAGGGAAAGCCGAGGGAGGCAGG - Intronic
1091882498 12:3990900-3990922 CAGGGAAAGCAGAGGCCGCCTGG + Intergenic
1092168806 12:6360448-6360470 TAGGGAAAGCACAGGTGTCCAGG + Intronic
1092758030 12:11783241-11783263 GAGGGAAATCACAGAGATCAAGG + Intronic
1095965481 12:47864434-47864456 CAGGGGAAGCACTGGGTTCTAGG - Intronic
1096226662 12:49870439-49870461 CAGGGGAGGGACAGGGAACCAGG + Exonic
1097171284 12:57114873-57114895 CAGGAAAATCACTGGAATCCGGG + Intronic
1098391366 12:69972966-69972988 CTGGGAAAACACATGGATTCTGG + Intergenic
1098786054 12:74757003-74757025 CAGGAAAAGGACACGGATCCAGG + Intergenic
1098818994 12:75207125-75207147 CAGGGTAAACCCAGGGACCCCGG - Intronic
1100381110 12:94062796-94062818 AAGAGAAAGCACAGTGATCGTGG + Intergenic
1101444283 12:104726518-104726540 CAGGGAAATCCCAGTGATCATGG + Intronic
1103524771 12:121560503-121560525 AAGGGAAACCCCAGGGATCTAGG - Intronic
1104663569 12:130630971-130630993 AAGGGAAAGCCACGGGATCCAGG + Intronic
1104938921 12:132385731-132385753 CAGGGAAAACACAGAGAGGCTGG + Intergenic
1105855969 13:24372277-24372299 CAGGGAAAGCACTTGAACCCAGG - Intergenic
1107093869 13:36513815-36513837 CTGGGAAAAAACAGGGATCTTGG + Intergenic
1109004702 13:56857428-56857450 CAATGAAAGCACATGGACCCAGG + Intergenic
1110142299 13:72145430-72145452 CAAGCAGAGGACAGGGATCCAGG + Intergenic
1112225303 13:97533641-97533663 CAGGGAAAGAGCAGGGATTCTGG + Intergenic
1113917291 13:113882043-113882065 CTGGGGAAGCTCAGGGTTCCTGG + Intergenic
1114579978 14:23748462-23748484 CTGGGAACCCACAGAGATCCAGG - Intergenic
1115080370 14:29443709-29443731 CAGGCAAAGCAGAGGGAATCGGG - Intergenic
1116433285 14:44870559-44870581 CAGTGAAAGCACATGGACACAGG - Intergenic
1117432368 14:55680607-55680629 CAGGGAGAGCTTAGGTATCCTGG + Intronic
1118838848 14:69496177-69496199 CAAGGAGAGCACAGGGCTCTGGG - Intronic
1119647621 14:76359720-76359742 CAGGGAAAGCAGAGGGCTTGTGG + Intronic
1120649557 14:87115421-87115443 CAGGGAAAGCAGAGGGAAAAGGG - Intergenic
1122066315 14:99176298-99176320 CAGGCAGGGCACTGGGATCCCGG - Intronic
1122174906 14:99909670-99909692 CAGGGAAAGGACCTGGACCCAGG + Intronic
1122590662 14:102848043-102848065 CAAGGAAGGCACAGGCAGCCTGG + Intronic
1122775480 14:104115069-104115091 CAGAGATAGCCCTGGGATCCAGG - Exonic
1123578668 15:21696826-21696848 CAAGGAGTGCACTGGGATCCTGG + Intergenic
1123615295 15:22139308-22139330 CAAGGAGTGCACTGGGATCCTGG + Intergenic
1123994238 15:25707045-25707067 CTTGGAAAGCCCCGGGATCCAGG - Intronic
1125181197 15:36882459-36882481 CAGGGAGGGGACAGGGACCCCGG - Intergenic
1125584510 15:40810538-40810560 CAGGGAAAGGAGAGGGATCCAGG - Intronic
1125721985 15:41849581-41849603 CAGGAAGGGCACAGGGAGCCTGG + Intronic
1126742979 15:51796963-51796985 CAGGGACAGCACGGAGATGCTGG + Intronic
1127265158 15:57355142-57355164 CAGGGAAACCAAGGGGAGCCCGG - Intergenic
1128581448 15:68813197-68813219 GAGGGAAAGCACTGGGTTGCAGG + Intronic
1128592127 15:68908615-68908637 CAGGGAAAGCCCAGTGAGGCTGG + Intronic
1131123845 15:89841414-89841436 CAGGGAGAGGACAGGGAAGCTGG + Intronic
1131217447 15:90550750-90550772 CATGGAAAGCAAAGGGGTTCTGG - Intronic
1131456028 15:92583423-92583445 TAGGGAAAGCACGGGGGTCTGGG - Intergenic
1131519331 15:93101470-93101492 CAGGGGAAGTACAGGGCTGCTGG + Intergenic
1131609884 15:93949319-93949341 GAGGGAAAGCACTGCCATCCTGG - Intergenic
1132174129 15:99695126-99695148 GAGGGAAAGCACTCGGATCTTGG - Intronic
1202987538 15_KI270727v1_random:431071-431093 CAAGGAGTGCACTGGGATCCTGG + Intergenic
1132752432 16:1464972-1464994 CAGGGCAAGGACAGGGATCTTGG - Intronic
1133050718 16:3115841-3115863 TCGGGAAAGCACGGGGATCCGGG - Exonic
1133550643 16:6851643-6851665 CAGGGAAAGAACAAGGCTCTAGG + Intronic
1134233718 16:12449368-12449390 CACGGCAAGGACAGGGATCATGG + Intronic
1135267132 16:21037038-21037060 CAGGGATTACACAGGGATTCTGG - Intronic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1138443254 16:57047491-57047513 CAGAGAAAGCCCAGGGTCCCTGG - Intronic
1138528769 16:57623617-57623639 CAGGGAAAGAGCAGGGAGCCTGG - Intronic
1139916250 16:70430191-70430213 CAGGGTATGCCCAGGGATCCAGG + Intronic
1139941484 16:70608861-70608883 CAGGGAAAGCTCAGGCAGCGAGG + Intronic
1140208855 16:72955178-72955200 CAAGGAAGGCACAGGTTTCCAGG + Intronic
1141267097 16:82507327-82507349 CACAGATATCACAGGGATCCTGG - Intergenic
1141648238 16:85378702-85378724 CAGGGCAGGCACAGGGCTGCAGG - Intergenic
1142732994 17:1875000-1875022 CTGGGAAAGAACAGGGAATCAGG - Intronic
1142905787 17:3040958-3040980 CAGGGAAACCAGAGAGAGCCAGG - Intergenic
1143377631 17:6476808-6476830 CAGGGCAGGGACAGGGAACCAGG + Intronic
1144376614 17:14649070-14649092 CTGGGACAGCACAGGGTTGCTGG + Intergenic
1145825447 17:27873765-27873787 GAGGGAGAGCACAGGGAACACGG - Intronic
1147441622 17:40451016-40451038 CAGAGAAAGATCTGGGATCCAGG - Intronic
1147496018 17:40916540-40916562 CAAGGAAAGCTGAGGAATCCAGG - Intergenic
1148122828 17:45222542-45222564 CGGGGCACGCACAGGGGTCCCGG + Intronic
1148127193 17:45242942-45242964 CAGGGGAAGCACAGGGAGCCTGG - Intronic
1148148958 17:45384870-45384892 CACGGACAGCAGAGGCATCCCGG + Intergenic
1151313899 17:73310689-73310711 CTGGGAAAACACAGGGAACCTGG + Intronic
1151630756 17:75309330-75309352 CAGGGACGCCACAGGGCTCCAGG - Intergenic
1151961412 17:77407854-77407876 CAGGAAAAGAGCAGGGATCCAGG - Intronic
1152399819 17:80059164-80059186 CAGGGAAGGAATAGGAATCCGGG - Intronic
1152573302 17:81129775-81129797 CAGGGTCAGCACAGGGCTCAGGG + Intronic
1152635094 17:81427591-81427613 CTGAGCAAGCACGGGGATCCAGG - Intronic
1152757269 17:82092242-82092264 CAGGGAAGGCCCAGCGAGCCTGG + Intronic
1152769413 17:82158038-82158060 CCGGGAAAGAACGGGGAGCCCGG + Intronic
1152778608 17:82216702-82216724 CCCTAAAAGCACAGGGATCCAGG + Intergenic
1152913794 17:83021955-83021977 CAGAGAAAGAACAGGAATGCTGG + Intronic
1153822390 18:8843394-8843416 CTGGGAAAGCAAATGGAGCCAGG + Intergenic
1154978534 18:21482778-21482800 CAGCGAAAGCACAGGGAGCATGG + Intronic
1155442039 18:25872236-25872258 AAGGGGAAGTACAGGGATCTGGG - Intergenic
1155526527 18:26721514-26721536 CAGGGAAAGCCTAGGGATGCAGG - Intergenic
1160205154 18:76825294-76825316 CAGGGAACCCCCAGGGGTCCAGG - Intronic
1160553504 18:79711402-79711424 CAGGGAATGGCCAGGGCTCCTGG + Intronic
1160737702 19:671640-671662 CATGGGAGGCACAGGGGTCCTGG + Intergenic
1160782791 19:885226-885248 CAGGGACAGCAAAGGGACACAGG + Intronic
1161541762 19:4856101-4856123 CAGGGAAAGTCCAAGGATGCTGG + Intronic
1161820706 19:6529190-6529212 CAGGGAAGGCCCAGGGGTCCCGG + Intergenic
1162349279 19:10138919-10138941 CAGGGAAGCGACAGGGCTCCTGG - Intronic
1162438762 19:10679954-10679976 CAGGGAAAGGACAGGGTTCCAGG + Intronic
1162606277 19:11710538-11710560 CAGGAAAAACACGAGGATCCTGG + Intergenic
1163210523 19:15836725-15836747 CAGGGACAGGACAGGACTCCCGG + Intergenic
1163485447 19:17582868-17582890 GAGGTAAAGCACAGGGGACCGGG - Exonic
1164876349 19:31693437-31693459 CAGGGAAATGACAGGGTTGCTGG - Intergenic
1165689309 19:37851016-37851038 CAGGGAAGGCACAGTGAGTCTGG - Intergenic
1166142962 19:40815195-40815217 CAGGGATGGCAAAGAGATCCTGG - Intronic
1166305777 19:41936214-41936236 CAGGGAAGGCCGAGGGATCCAGG - Intergenic
1167230494 19:48279888-48279910 CAGGTAAAGCACATGGAGCCAGG + Intronic
1167320717 19:48795946-48795968 AAGGGATAGCCCAGGGCTCCAGG + Intronic
1167738141 19:51310174-51310196 CAGTGAAAGAACAGGGAGCCAGG + Intergenic
1168404230 19:56102662-56102684 CAGGGAAAGCTCAGGAGTGCAGG - Intronic
1168583067 19:57571324-57571346 CAGAGAAAGTGTAGGGATCCAGG + Intergenic
1168585950 19:57592034-57592056 CACAGAAAGAATAGGGATCCAGG - Exonic
1202704961 1_KI270713v1_random:15680-15702 CAGGCAGAGCTCAGGGATCTAGG - Intergenic
925077378 2:1028591-1028613 AAGGGAAAGCAGAGGGTTTCTGG - Intronic
927317859 2:21706547-21706569 CAGGAAAGGCACAGGGAACTAGG - Intergenic
928293442 2:30060605-30060627 TAGGGAAAACACAGTGATTCTGG + Intergenic
928887745 2:36169417-36169439 CAAGGAAGGTACAGGGAGCCTGG - Intergenic
929468682 2:42169585-42169607 CGGGGAAAGCGCCGGGCTCCGGG - Exonic
932720469 2:74135078-74135100 CAGGAAAAGAACCCGGATCCTGG + Intronic
934080936 2:88467331-88467353 CTGGGAAAGCAGAGGGATAGGGG + Intergenic
934694772 2:96391633-96391655 CAGGGAAGGCACAGTGAGTCAGG + Intergenic
935580191 2:104750048-104750070 CAGCAAAAGCACAGGGTTCCAGG + Intergenic
935649445 2:105369868-105369890 CAGGGAATGCACAGGGCACCTGG + Intronic
936442242 2:112564621-112564643 GAGGGAATGCACAGGCATTCTGG - Intronic
936657768 2:114507545-114507567 CAGGAAAATCACAGTGATACTGG - Intronic
937298738 2:120825680-120825702 CAGGCAAAGGACAGGCATCTGGG - Intronic
937905371 2:127050370-127050392 CAGGGGGACCACAGGCATCCTGG - Intronic
937999379 2:127719980-127720002 CAAGGAATGCAGAGGCATCCTGG - Exonic
938134419 2:128742658-128742680 CAGGGATAGGACAGGGAGCCAGG + Intergenic
938922343 2:136006861-136006883 AGGGGAAAGCACAGGATTCCAGG - Intergenic
940180676 2:150929092-150929114 CAGTGAGAGGACAGGGATCCTGG - Intergenic
941897458 2:170643783-170643805 CAGGCAACGCACAGGGGTCCTGG - Intronic
942573822 2:177341547-177341569 CAGGGAAAGTACAGGGAAAGTGG + Intronic
945868658 2:215203560-215203582 CAGGAAAAGGGCAGGGGTCCTGG - Intergenic
946309661 2:218876386-218876408 CGGGGGAAGGACAGGGGTCCTGG - Intergenic
946396227 2:219444981-219445003 CAAGGCAAGCACAGGCAACCGGG + Exonic
947301005 2:228688754-228688776 CAGGGTAAGCCCAGGGATCGGGG - Intergenic
948568193 2:238899571-238899593 CAGGGAGAGCTCAGGAAACCAGG + Intronic
948581885 2:238992912-238992934 CAGGTAAAGCACAGGTCCCCAGG + Intergenic
948807402 2:240458975-240458997 CTGGGACAGCACTGGGAGCCAGG - Intronic
949051238 2:241898697-241898719 CAGGCACAGCCCAGGGACCCAGG - Intronic
1169084057 20:2816129-2816151 CAGGAAAGGGACAGGGATCCAGG + Intergenic
1169421819 20:5466541-5466563 CAGGTAAAGCCCAGGGATCCTGG - Intergenic
1169464187 20:5823141-5823163 CAAGGGAAGAACAGGTATCCGGG - Intronic
1170171074 20:13413234-13413256 TAGGGAAAGCACAGGGCACTGGG - Intronic
1171060823 20:21957387-21957409 AGGGGATATCACAGGGATCCAGG + Intergenic
1171307892 20:24121462-24121484 CAGGGACAGCTCTCGGATCCTGG + Intergenic
1173042172 20:39474906-39474928 CAAGGCAAGCACAGGGAACAGGG - Intergenic
1173540205 20:43845269-43845291 CAGGAAAAGCACTGGGCTTCAGG - Intergenic
1174078679 20:47956024-47956046 CAGGGAAAGCACAGGGTTCTAGG + Intergenic
1174615047 20:51829018-51829040 CAGGGAAAAGCCAGGGAGCCAGG - Intergenic
1175318825 20:58071241-58071263 CAGGAAATGCACAGGGCACCAGG - Intergenic
1175624793 20:60481379-60481401 CAGGGAATGCAGAGGGACCCTGG - Intergenic
1176115609 20:63430720-63430742 CAGGGGAACCCCAGGGCTCCAGG - Intronic
1177230046 21:18307981-18308003 CAGGGAAAGCCCAGTCATCCGGG + Intronic
1178534820 21:33403121-33403143 CAGGGAAAGCCCGGGGGTCTGGG + Exonic
1178902486 21:36608448-36608470 CATGGAAGACACTGGGATCCGGG - Intergenic
1179290464 21:40013765-40013787 CAGGGAGAGCACAGGGTTTGAGG + Intronic
1179520684 21:41942473-41942495 CTGGGAAAGGACAGGAACCCGGG + Intronic
1180559243 22:16602033-16602055 CAGGAAAGACACATGGATCCCGG - Intergenic
1182556870 22:31134073-31134095 TAGGGCAAGCCCAGGGAACCTGG - Exonic
1183408325 22:37641011-37641033 CAGTGGAAGCACTGGGGTCCAGG + Intronic
1183515253 22:38261807-38261829 CAGAGCAGGTACAGGGATCCTGG - Intronic
1183573970 22:38675217-38675239 CAGTGAGAGCAAAGGGAGCCTGG - Intergenic
1184058568 22:42068155-42068177 CAGGGGAAGTACAGGGGGCCTGG + Intronic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
1185342580 22:50298258-50298280 CAAGGGCAGCACAGGGATGCTGG + Intronic
949247461 3:1942215-1942237 CAGGGAAAGAAAAGGGAACCCGG - Intergenic
949588519 3:5467815-5467837 CAGAGAAAGCACAGGGCTTTGGG - Intergenic
949605831 3:5652493-5652515 CAGGGATGGCAAAGGGACCCTGG + Intergenic
950410939 3:12836504-12836526 CAAGCAATGGACAGGGATCCGGG + Intronic
950707640 3:14792890-14792912 CAGGGAGAGCACAGGCATCCAGG - Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951204992 3:19916586-19916608 CAGGGAAATCACTGGAATCAGGG + Intronic
951437097 3:22677189-22677211 CAGGGATAGCACAGTGATTGTGG - Intergenic
951604280 3:24415205-24415227 AAGGTAATGCACAGAGATCCAGG - Intronic
953660235 3:44886603-44886625 GAGGGAATGCACATGGACCCAGG - Intronic
954043637 3:47910220-47910242 CATGGAAACCACAGGGGACCAGG - Intronic
954300524 3:49698619-49698641 CAGGGAAGGGTCAGGGACCCAGG + Intronic
958537248 3:95419011-95419033 CAGAGAGAGGACAGGGACCCTGG - Intergenic
960373626 3:116871287-116871309 CAATGAGAGCACATGGATCCAGG - Intronic
962283339 3:134067942-134067964 CGAGGAAGGCACAGGGAGCCTGG + Intronic
963978254 3:151507151-151507173 CAGGGAAAGCAGAGGAATAAAGG - Intergenic
965084505 3:164077476-164077498 CAGGGAAAGCAGAGGGAAAAAGG + Intergenic
965439865 3:168699419-168699441 CAGGGCAGGCACAGGGGCCCTGG - Intergenic
967427192 3:189340714-189340736 CAGGGAAAGCCAAGGGCTCCAGG - Intergenic
967845202 3:194037386-194037408 CAGGGAAATCACTTGAATCCAGG + Intergenic
968782949 4:2596990-2597012 CAGGGAATGCACACGTTTCCTGG - Intronic
969490511 4:7496830-7496852 TGGGGAAGGCACAGGGCTCCGGG + Intronic
969500100 4:7547435-7547457 CAGGCACAGCACAGGCAGCCTGG - Intronic
970609593 4:17712640-17712662 CAGGGCAACATCAGGGATCCTGG + Intronic
971299221 4:25428242-25428264 CAGGCAAAGCACAGGCTTCCTGG + Intergenic
971588318 4:28433201-28433223 CAGGGAAATGACAGGGAACATGG - Intergenic
972537033 4:40008353-40008375 CAGGAAATGCACAGGGAGCTTGG - Intergenic
973686828 4:53378181-53378203 CGGGGAAAGCACAGCGAAGCCGG - Intronic
973960449 4:56104621-56104643 CAGGGAAAGCACAGAGCTCGTGG - Intergenic
975252012 4:72191645-72191667 AAAGGAAAGCAAAGGGACCCTGG - Intergenic
975325804 4:73057331-73057353 CAGGAAAATCACTGGAATCCGGG + Exonic
975503198 4:75110032-75110054 CCTGGGAAGCACAGGGGTCCAGG + Intergenic
976443704 4:85106468-85106490 CAGGGAAAGAACAGTGATTTTGG - Intergenic
976876859 4:89863291-89863313 CAGGGAAGGCCCAGAGATACTGG + Intergenic
977440658 4:97063085-97063107 AGGGGAAAGCACAGAGCTCCAGG - Intergenic
978733685 4:112061325-112061347 GAGGGACAGCACAGTGATCATGG + Intergenic
979046987 4:115879612-115879634 CAGAGAAAGAGCAGGGATCGGGG + Intergenic
979409000 4:120351267-120351289 TAGGGCAAGCACTGGGAGCCAGG + Intergenic
979945724 4:126829534-126829556 CAGGGAAAGCACAGTGATTGCGG + Intergenic
980872687 4:138627435-138627457 CCTGGAAAACACAGGGATCAGGG - Intergenic
982201683 4:152967624-152967646 CATGGAAAGCATATGAATCCCGG + Intronic
982241757 4:153306837-153306859 CAGGGCAAGGACTGGGAGCCTGG - Intronic
982592909 4:157337915-157337937 CAGGGAAGTCACAGGGAATCTGG - Intronic
984220913 4:176973404-176973426 CAGGGAAAACACAGGGAAACTGG + Intergenic
984296548 4:177861646-177861668 CCCCGAGAGCACAGGGATCCTGG - Intronic
984651935 4:182279803-182279825 CAGGGACACCACAGAGCTCCTGG - Intronic
985655500 5:1129534-1129556 CAGGGAAACCACAGCGTCCCAGG + Intergenic
985662670 5:1165103-1165125 CAGGGAGGGCACAGGGCTCTCGG + Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
986947457 5:13041410-13041432 CAGTGAAACCACTGGGTTCCAGG - Intergenic
988844155 5:35112557-35112579 GAGGGAAAGCACTGGGCTCAAGG + Intronic
990889289 5:60631559-60631581 CAGGGAAAGCAAGTGGATTCTGG + Intronic
992167794 5:74072066-74072088 GAGGCATATCACAGGGATCCAGG + Intergenic
992229673 5:74651729-74651751 GAGGAAAAGCACAGAGATGCTGG - Intronic
994247026 5:97489482-97489504 CCTGGAGAGTACAGGGATCCCGG + Intergenic
995618552 5:113996074-113996096 AAAGGAAAGAACTGGGATCCGGG + Intergenic
996846549 5:127905043-127905065 CAGCAAAAGCCCAGGGATTCAGG - Intergenic
998567179 5:143226048-143226070 CTGGGAAAGCTCAGGGATCCTGG - Exonic
999149424 5:149417019-149417041 CCAGGAAAGCACTGGGGTCCTGG - Intergenic
999684426 5:154089484-154089506 CAGGGCTAGCAGAGGGATCCAGG - Intronic
1001225476 5:169941119-169941141 AAGGGAAAGCACAGGGTGTCGGG + Intronic
1001235366 5:170024881-170024903 GAGGGAAATTACAGGGTTCCAGG - Intronic
1001334534 5:170786231-170786253 CAGGGAAAGGACAGGGATTGGGG + Intronic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1001995400 5:176153414-176153436 CACTGAAAGCTCAGAGATCCTGG - Intergenic
1002759091 6:187996-188018 CTGGGAAAGCCCAGGGGTCTAGG - Intergenic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1003084766 6:3052709-3052731 CTGGGAAAGCCCAGGGAAGCAGG + Intergenic
1003119011 6:3304883-3304905 CAGGGAGAGGAGAGGGATGCAGG + Intronic
1003182501 6:3804260-3804282 CAGGAAAAGCACAGGAAACAGGG + Intergenic
1003528651 6:6919691-6919713 CAAGGTAAGCTCAGGGATTCTGG - Intergenic
1004426033 6:15507794-15507816 CAGGGAAAGCCAAGGGGTCATGG + Intronic
1005871194 6:29975344-29975366 CAGGGAGAGGACAGGGCTTCAGG + Intergenic
1008089980 6:47284107-47284129 CAGGAAAAGCACAATCATCCAGG + Exonic
1012680086 6:102169259-102169281 CAGTGAAAACACAGGGACACAGG + Intergenic
1014014866 6:116518480-116518502 CAGGGACAGAACAGGGATTAGGG + Exonic
1014919926 6:127202086-127202108 CAGGGACAGCACAGTGCCCCAGG - Intergenic
1015357366 6:132294459-132294481 CAGCTACAGCACAGTGATCCAGG - Intergenic
1017027208 6:150191925-150191947 TAGGGAAAGAAGAGGGTTCCAGG + Intronic
1018519768 6:164635165-164635187 CCAGGAATGCACAGGGATGCTGG + Intergenic
1018730916 6:166649805-166649827 CTTGGAAAGCACAGAGAACCTGG + Intronic
1019181839 6:170192307-170192329 CATGGAGACCACAGGGTTCCTGG + Intergenic
1019577123 7:1743020-1743042 CAGGGAAAACACAGGCGGCCGGG + Intronic
1019608083 7:1920113-1920135 CTGGGGAAGGACAGGGATGCTGG - Intronic
1019621259 7:1993289-1993311 CAGGGAGGGCACAGGGCTTCTGG + Intronic
1020341952 7:7121352-7121374 CAGGAAAAGCACTTGAATCCGGG - Intergenic
1021011145 7:15467914-15467936 CAGGGAGGGTACGGGGATCCAGG - Intronic
1023882282 7:44327106-44327128 CTGAGGAAGCAGAGGGATCCTGG + Intronic
1024062692 7:45710619-45710641 GATGGATAGCACAGGGGTCCAGG + Exonic
1025030389 7:55552071-55552093 GAGGGAAAGCCCTGGGAGCCAGG + Intronic
1026952201 7:74355069-74355091 CAGGGACTGCACAGGGACTCAGG - Intronic
1029257312 7:99278306-99278328 CAGGGAAAGTCCAGGGATGGTGG + Intergenic
1029559146 7:101290897-101290919 CAGTGAAAACACAGGGGTCTTGG + Intergenic
1029710411 7:102296115-102296137 CAGGGACAGAACAGGGCTCCCGG - Intronic
1030081525 7:105782670-105782692 CAGGGAACGCAGAGAGATACTGG + Intronic
1030362665 7:108611098-108611120 GAGAGAAAGCACAAGGATTCTGG - Intergenic
1031215327 7:118883094-118883116 GAGGGAGAGCACAGTGATCGGGG + Intergenic
1031854986 7:126911665-126911687 CAGGGGAAGCAGAGAAATCCAGG + Intronic
1032188350 7:129747084-129747106 CAGGCAGAGCACAGGGCTGCAGG - Intronic
1033318898 7:140321956-140321978 CAGTGAAAACACAGAGAACCTGG + Intronic
1034533265 7:151710564-151710586 CAGGGAGAGGGCAGGGCTCCCGG - Intronic
1034618003 7:152435796-152435818 CAGGAAAGACACATGGATCCCGG + Exonic
1034860645 7:154592052-154592074 CTGCGAAAGCAAAGGGAGCCTGG - Intronic
1035162082 7:156958603-156958625 CAGTGAAAAAACAGGGTTCCAGG + Intronic
1035241276 7:157531261-157531283 CAGGGAAAGCAGAAGCTTCCCGG + Intergenic
1035464589 7:159066248-159066270 CAGTGAAGGAACAGGCATCCTGG - Intronic
1036636273 8:10551831-10551853 GATGGAAAGCACAGGGAATCTGG - Intronic
1036801124 8:11793557-11793579 CAGGAAATGCACAGGTGTCCTGG - Intergenic
1037065213 8:14568180-14568202 CAATGAAAGCACATGGATCCAGG + Intronic
1037282459 8:17257438-17257460 CAGTGAAAACACATGGATACAGG + Intronic
1037663360 8:20945298-20945320 CAGGGGAAGCACACAGAGCCAGG + Intergenic
1038413416 8:27375676-27375698 CAGGGAAAGAACACGGCCCCCGG - Intronic
1039121913 8:34157326-34157348 CACACACAGCACAGGGATCCAGG - Intergenic
1040109596 8:43561386-43561408 CTGGGAAGGCACTGGCATCCTGG + Intergenic
1040300836 8:46187216-46187238 CAGTGAGACCACAGGGATGCTGG - Intergenic
1041222580 8:55666122-55666144 CAAGGAAAGCACAGTGACACTGG + Intergenic
1042426640 8:68656753-68656775 CCAGGAAGGCAGAGGGATCCAGG - Intronic
1042546614 8:69956837-69956859 CAGGGCAGCCACAGGGTTCCGGG + Intergenic
1043390334 8:79785541-79785563 CAGCGGCAGCACAGGGCTCCAGG + Intergenic
1043648925 8:82562132-82562154 CAGGGAAAGAACACTGATCTTGG + Intergenic
1044610002 8:94082037-94082059 CAAAAGAAGCACAGGGATCCTGG - Intergenic
1045660485 8:104432460-104432482 CAGAAAAAGCATAGGCATCCAGG + Intronic
1046588043 8:116171711-116171733 CAGGGCAATCACATGAATCCAGG + Intergenic
1048301760 8:133256532-133256554 CAGGGAAAGCACTGGGACACAGG - Intronic
1048493892 8:134919766-134919788 CAGGTAAATCACTGGGATTCAGG - Intergenic
1048822201 8:138390959-138390981 CAGGGAAAGCAAAAGTTTCCAGG + Intronic
1049340527 8:142109911-142109933 CAGGGAAACCACAGGCTTCATGG - Intergenic
1049572618 8:143376351-143376373 CAGGGGCAGCAGTGGGATCCGGG - Intronic
1050470813 9:5987914-5987936 CAGAGTAAGCACAGTTATCCAGG + Intronic
1051131496 9:13866212-13866234 TGAGGAAAGCATAGGGATCCTGG - Intergenic
1051821751 9:21178728-21178750 CAGGGAATGCATGGGAATCCAGG - Intergenic
1053314407 9:37039263-37039285 CAGGGAAAGCACCCCAATCCTGG - Intergenic
1055713591 9:79091948-79091970 CAGGGAAATCACTTGAATCCGGG + Intergenic
1059449183 9:114359650-114359672 CAGGGAAAGCAGAGGCCACCAGG - Exonic
1060211293 9:121712106-121712128 CAGGAAAAGCAGAGGAGTCCAGG - Intronic
1060963333 9:127697059-127697081 CAGGTAATGCACAGGGGACCAGG - Intronic
1061212453 9:129201797-129201819 CAGTGAAAACACAGGGCTCGGGG - Intergenic
1061271646 9:129547122-129547144 CAGGGAAAGTGGAGGGGTCCTGG - Intergenic
1061654622 9:132079519-132079541 AAGAGAAAGAACAGGGATCAAGG + Intronic
1061672844 9:132198733-132198755 CAGGTAACGCCCAGGGAACCAGG - Intronic
1061926979 9:133810752-133810774 CAGGGACAGCAGCGGGCTCCAGG + Intronic
1062131465 9:134896296-134896318 CATGGAAGGCACAGGGCTCTGGG - Intergenic
1062209777 9:135357213-135357235 CAGAGAAAGCCAAGGGATCCAGG + Intergenic
1062344409 9:136108294-136108316 CAGGCCAGGCACAGGGATGCTGG - Intergenic
1062403161 9:136381331-136381353 CAGGGTAAACACAGGGGTGCTGG + Exonic
1187115774 X:16348928-16348950 AAGGGAAAGCACAGAGAACCTGG - Intergenic
1188870277 X:35363866-35363888 CAGGAAAAGCAAAGGAATCTAGG + Intergenic
1189628050 X:42920736-42920758 GAGGGAGAGCACAGTGATCGTGG + Intergenic
1190685577 X:52869654-52869676 CAGGGCAAGCACAGGTAGACTGG + Intergenic
1193049365 X:77084292-77084314 CAGGCAAAGCACTTGAATCCAGG + Intergenic
1194061882 X:89213512-89213534 CAGGAGAATCACAGGAATCCGGG + Intergenic
1195327844 X:103772468-103772490 CAGGGGAAGTATAGGAATCCTGG + Intergenic
1195681459 X:107550015-107550037 CAGGGAAAGGACAAGGAGACCGG - Intronic
1195693929 X:107652841-107652863 CAGGAAAATCACATGAATCCGGG - Intergenic
1197670703 X:129273799-129273821 GAGGGAAAGCACAGTGATTGTGG - Intergenic
1200073691 X:153541037-153541059 CCAGGAAAGCACAGGGACCTGGG + Intronic
1200150739 X:153950190-153950212 CAGGGAAGGCCCAGGAAGCCGGG - Intronic
1200715808 Y:6542814-6542836 CAGGAGAATCACAGGAATCCGGG + Intergenic