ID: 922808309

View in Genome Browser
Species Human (GRCh38)
Location 1:228401858-228401880
Sequence GGGAGCCCACGCCCACGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 129}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922808296_922808309 18 Left 922808296 1:228401817-228401839 CCCAAGCATGCTGGGACCCCAGG 0: 1
1: 0
2: 2
3: 29
4: 326
Right 922808309 1:228401858-228401880 GGGAGCCCACGCCCACGACCTGG 0: 1
1: 1
2: 0
3: 14
4: 129
922808298_922808309 17 Left 922808298 1:228401818-228401840 CCAAGCATGCTGGGACCCCAGGA 0: 1
1: 0
2: 6
3: 36
4: 663
Right 922808309 1:228401858-228401880 GGGAGCCCACGCCCACGACCTGG 0: 1
1: 1
2: 0
3: 14
4: 129
922808295_922808309 21 Left 922808295 1:228401814-228401836 CCACCCAAGCATGCTGGGACCCC 0: 1
1: 0
2: 0
3: 29
4: 253
Right 922808309 1:228401858-228401880 GGGAGCCCACGCCCACGACCTGG 0: 1
1: 1
2: 0
3: 14
4: 129
922808302_922808309 2 Left 922808302 1:228401833-228401855 CCCCAGGATGGGGCCCTTGCAGT 0: 1
1: 0
2: 2
3: 18
4: 237
Right 922808309 1:228401858-228401880 GGGAGCCCACGCCCACGACCTGG 0: 1
1: 1
2: 0
3: 14
4: 129
922808304_922808309 0 Left 922808304 1:228401835-228401857 CCAGGATGGGGCCCTTGCAGTAT 0: 1
1: 0
2: 1
3: 12
4: 154
Right 922808309 1:228401858-228401880 GGGAGCCCACGCCCACGACCTGG 0: 1
1: 1
2: 0
3: 14
4: 129
922808303_922808309 1 Left 922808303 1:228401834-228401856 CCCAGGATGGGGCCCTTGCAGTA 0: 1
1: 0
2: 0
3: 31
4: 834
Right 922808309 1:228401858-228401880 GGGAGCCCACGCCCACGACCTGG 0: 1
1: 1
2: 0
3: 14
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922808309 Original CRISPR GGGAGCCCACGCCCACGACC TGG Intronic