ID: 922814841

View in Genome Browser
Species Human (GRCh38)
Location 1:228441249-228441271
Sequence TAGAATCCTGACTTTGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922814835_922814841 12 Left 922814835 1:228441214-228441236 CCAGGAGGGAGAAGGCCTTAGTC No data
Right 922814841 1:228441249-228441271 TAGAATCCTGACTTTGGGCCTGG No data
922814837_922814841 -3 Left 922814837 1:228441229-228441251 CCTTAGTCTCTGCCAGAAGGTAG No data
Right 922814841 1:228441249-228441271 TAGAATCCTGACTTTGGGCCTGG No data
922814833_922814841 21 Left 922814833 1:228441205-228441227 CCTTTGAAACCAGGAGGGAGAAG No data
Right 922814841 1:228441249-228441271 TAGAATCCTGACTTTGGGCCTGG No data
922814831_922814841 26 Left 922814831 1:228441200-228441222 CCATTCCTTTGAAACCAGGAGGG No data
Right 922814841 1:228441249-228441271 TAGAATCCTGACTTTGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922814841 Original CRISPR TAGAATCCTGACTTTGGGCC TGG Intergenic
No off target data available for this crispr