ID: 922814866

View in Genome Browser
Species Human (GRCh38)
Location 1:228441381-228441403
Sequence GACTCTGTACTGACTGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922814860_922814866 5 Left 922814860 1:228441353-228441375 CCACCCCTACACAAATTACAATG No data
Right 922814866 1:228441381-228441403 GACTCTGTACTGACTGCAGCTGG No data
922814854_922814866 26 Left 922814854 1:228441332-228441354 CCTTCCCTTTAAGACACCCCGCC No data
Right 922814866 1:228441381-228441403 GACTCTGTACTGACTGCAGCTGG No data
922814859_922814866 8 Left 922814859 1:228441350-228441372 CCGCCACCCCTACACAAATTACA No data
Right 922814866 1:228441381-228441403 GACTCTGTACTGACTGCAGCTGG No data
922814863_922814866 1 Left 922814863 1:228441357-228441379 CCCTACACAAATTACAATGGAGG No data
Right 922814866 1:228441381-228441403 GACTCTGTACTGACTGCAGCTGG No data
922814855_922814866 22 Left 922814855 1:228441336-228441358 CCCTTTAAGACACCCCGCCACCC No data
Right 922814866 1:228441381-228441403 GACTCTGTACTGACTGCAGCTGG No data
922814857_922814866 10 Left 922814857 1:228441348-228441370 CCCCGCCACCCCTACACAAATTA No data
Right 922814866 1:228441381-228441403 GACTCTGTACTGACTGCAGCTGG No data
922814862_922814866 2 Left 922814862 1:228441356-228441378 CCCCTACACAAATTACAATGGAG No data
Right 922814866 1:228441381-228441403 GACTCTGTACTGACTGCAGCTGG No data
922814865_922814866 0 Left 922814865 1:228441358-228441380 CCTACACAAATTACAATGGAGGC No data
Right 922814866 1:228441381-228441403 GACTCTGTACTGACTGCAGCTGG No data
922814856_922814866 21 Left 922814856 1:228441337-228441359 CCTTTAAGACACCCCGCCACCCC No data
Right 922814866 1:228441381-228441403 GACTCTGTACTGACTGCAGCTGG No data
922814858_922814866 9 Left 922814858 1:228441349-228441371 CCCGCCACCCCTACACAAATTAC No data
Right 922814866 1:228441381-228441403 GACTCTGTACTGACTGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922814866 Original CRISPR GACTCTGTACTGACTGCAGC TGG Intergenic
No off target data available for this crispr