ID: 922818214

View in Genome Browser
Species Human (GRCh38)
Location 1:228466306-228466328
Sequence GAAAGTGCACAGATGGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 13, 3: 68, 4: 284}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922818214_922818216 -3 Left 922818214 1:228466306-228466328 CCTGGGTCCATCTGTGCACTTTC 0: 1
1: 0
2: 13
3: 68
4: 284
Right 922818216 1:228466326-228466348 TTCTTGTGAAATCCAGTTTTAGG 0: 1
1: 0
2: 3
3: 28
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922818214 Original CRISPR GAAAGTGCACAGATGGACCC AGG (reversed) Intergenic
900521101 1:3105941-3105963 TAAGGAGCACAGGTGGACCCCGG - Intronic
900812571 1:4818275-4818297 GGAAGTGCACAGATGGGCCAAGG + Intergenic
900842944 1:5070461-5070483 GGAAGTGCACAGATGGGCCTAGG - Intergenic
900883859 1:5401814-5401836 GGAAGTGCACAGATGGGCCTAGG - Intergenic
900913692 1:5619853-5619875 GAAAGTGTACAGAGGGGCCTAGG + Intergenic
900979842 1:6040137-6040159 GAAAGTACACAGATGCCCCCTGG + Intronic
901158104 1:7154225-7154247 GAAGATGAACAGATTGACCCTGG + Intronic
901746462 1:11376983-11377005 TCAAGTGCACAGATGGACCTGGG - Intergenic
902043182 1:13506984-13507006 GACAGTGGACAGATAGCCCCAGG - Intronic
902657546 1:17879710-17879732 GGGAGAGCACAGATGTACCCAGG + Intergenic
904306857 1:29595370-29595392 GAAGGAGCACAGATGCACCCTGG - Intergenic
904314363 1:29650716-29650738 GGCTGTGCACAGATGGACACAGG - Intergenic
904830431 1:33303009-33303031 GAAAGAGCAGAAATGGACCAAGG + Intergenic
907158370 1:52354409-52354431 GAAATCTCACAGAGGGACCCAGG - Intronic
908395856 1:63725161-63725183 GGAAGTGTACAGATGGGCCTAGG - Intergenic
909611026 1:77552001-77552023 GGAAGTGCACAGATGGGCCTAGG - Intronic
911048336 1:93648067-93648089 GAAAAAGAAAAGATGGACCCAGG - Intronic
911511982 1:98818099-98818121 GAAAGGGCACAGATGGACAAGGG - Intergenic
914256051 1:145961773-145961795 GCGAGGGCACAGATGGAGCCGGG + Exonic
915289808 1:154875931-154875953 GAAAGAGCACAGACAGACCCAGG - Intergenic
916475464 1:165164495-165164517 CAAAGTGCACAGAAGGTCTCTGG - Intergenic
916721627 1:167488657-167488679 GAAAGTACACAGATGGGCCTAGG + Intronic
916738482 1:167628983-167629005 GAAAGTGCAAAGATGGTGCCGGG + Intergenic
918093918 1:181318844-181318866 GAAAGAGCACAGAGGAAGCCAGG + Intergenic
920055883 1:203191363-203191385 GGAAGTGCACAGATGGGCCTAGG - Intergenic
920208980 1:204314457-204314479 GTAAGTGCAGAGAAGGATCCTGG + Intronic
920725213 1:208428524-208428546 AATAGTGCTCAGATGAACCCTGG - Intergenic
922222543 1:223619353-223619375 GGAGGTGCACAAATGGAACCTGG - Exonic
922232572 1:223699670-223699692 GGAAGTGCACAGATGGGCCTAGG - Intergenic
922599536 1:226839041-226839063 GAAGGTGCACAGATGGGCCTAGG + Intergenic
922767553 1:228163743-228163765 GCAAGTGCACAGATGGGCCTAGG - Intergenic
922818214 1:228466306-228466328 GAAAGTGCACAGATGGACCCAGG - Intergenic
923142886 1:231176076-231176098 GAAGGGACACAGATGGACTCAGG - Intronic
924431250 1:243998573-243998595 GGAAGTGGACAGATGGAGCGCGG - Intergenic
924669129 1:246105229-246105251 TAAAATGCACAGATGGGCCCTGG + Intronic
924727071 1:246681002-246681024 GAAAGAGACCAGATGGACCTTGG - Intergenic
924871465 1:248051184-248051206 GAAAGTGGAATGGTGGACCCTGG - Intronic
924875987 1:248105132-248105154 CAATGTGAACACATGGACCCAGG - Intergenic
1063102532 10:2962983-2963005 GAAAGTGGACGGAGGGAACCGGG - Intergenic
1066443595 10:35461559-35461581 GGAAGTGCACAGTTGGGCCCAGG + Intronic
1066515029 10:36149079-36149101 AAAAGTGCACATATGGCCCTGGG - Intergenic
1067250021 10:44578279-44578301 GGAAATGCACAGATGGGTCCAGG + Intergenic
1068139984 10:52993747-52993769 TGAAGAGCACAGATGGACCTAGG - Intergenic
1069795299 10:71048042-71048064 GAGAATCCAGAGATGGACCCAGG + Intergenic
1071223111 10:83492987-83493009 GAAAGTGCACAGATGGGCCTAGG + Intergenic
1071425019 10:85540617-85540639 GGAAGTGCATAGATGGGCCTGGG + Intergenic
1072160361 10:92760532-92760554 GAAATTCCACCGGTGGACCCTGG - Intergenic
1072576434 10:96704808-96704830 TAATGTGCACAGAAGGACCTGGG - Intronic
1073053762 10:100686224-100686246 GAAAGTGCAGTGATGGTCCCAGG + Intergenic
1074563468 10:114554888-114554910 GACACTGAACAGAGGGACCCTGG + Intronic
1075121668 10:119669147-119669169 GGAAGTGCACAGATGGGCCTAGG + Intronic
1075385456 10:122052216-122052238 GAAAGAGAAGAGCTGGACCCTGG - Intronic
1075624768 10:123954298-123954320 GGAAGTGCACAGACGGGCCGAGG + Intergenic
1075742439 10:124704077-124704099 CCAACTGCACAGCTGGACCCGGG + Intronic
1076436019 10:130442053-130442075 GACAGGGCACTGATGTACCCAGG - Intergenic
1076687534 10:132204811-132204833 GAAAGGGCACAGATGGGCAGGGG - Intronic
1080210779 11:29782383-29782405 GAATAAGCACAGATGGATCCTGG + Intergenic
1082180280 11:49108649-49108671 GAAAGTGCACTGCTGGAATCAGG - Intergenic
1082283022 11:50291025-50291047 GAAAGTACACTGTTGGACCAGGG + Intergenic
1084661113 11:70546917-70546939 GGAAGCGCACAGATGGACTCAGG - Intronic
1085211297 11:74781758-74781780 GTAAGTGCACAGGCAGACCCTGG + Intronic
1085923117 11:80982270-80982292 CAAAGTGGCCAGCTGGACCCAGG + Intergenic
1086952820 11:92908559-92908581 GAAAGTGGACAGAGGTACCCCGG + Intergenic
1087357890 11:97117930-97117952 GGAAGTACACAGATGGTCCTAGG + Intergenic
1087766566 11:102161320-102161342 GAAAGTACACAGAAAGACTCTGG - Intronic
1087899600 11:103625928-103625950 GGAAGTGCACAGATGGGCAAAGG + Intergenic
1090286760 11:125506346-125506368 GGAAGTGCACAGATTGATCTAGG - Intergenic
1092525505 12:9307236-9307258 CAAAGTGCACAGCTGGATTCAGG - Intergenic
1092541772 12:9424584-9424606 CAAAGTGCACAGCTGGATTCAGG + Intergenic
1094364490 12:29665690-29665712 GAAAGTACACAGATGGGCCTAGG - Intronic
1094511263 12:31097919-31097941 CAAAGTGCACAGCTGGATTCAGG - Exonic
1095196763 12:39328429-39328451 GAAAAGACACAGATGGACTCTGG - Intronic
1096713930 12:53479489-53479511 GAAACTACACAGATGGATCATGG - Exonic
1096914387 12:55016220-55016242 GCAAGTGCAGAAATGGACGCTGG + Intergenic
1097387089 12:58962937-58962959 GGAGGTGCACAGATGGGCCTAGG - Intergenic
1098580519 12:72094193-72094215 GAAAGTCCACAGATGACACCAGG + Intronic
1098878392 12:75891188-75891210 GAAAGTACACAGATGAGCCTAGG - Intergenic
1099926752 12:89027917-89027939 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1100751366 12:97701934-97701956 GGAAATGCACAGATGGGCCTAGG - Intergenic
1100763757 12:97839437-97839459 GGAAGTACACAGATGGGCCCAGG + Intergenic
1100911349 12:99366524-99366546 GAAAGTCCAGAAATAGACCCAGG + Intronic
1100950377 12:99842427-99842449 GGAAGTACACAGATGGGCCTAGG - Intronic
1101153840 12:101908779-101908801 GGAAGTGCACAGATGGACCTAGG + Intronic
1101880136 12:108620797-108620819 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1102504103 12:113372970-113372992 GCAAGTGGACAGATGGAGACTGG - Intronic
1102637480 12:114336756-114336778 GGAAGTACACAGATTGGCCCAGG - Intergenic
1103944719 12:124519613-124519635 GGAAGTGGTCAGATGGACTCTGG + Intronic
1104546134 12:129714424-129714446 GCCAGGGCACAGATGGACACTGG + Intronic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1106825786 13:33518994-33519016 TAAAGTGCTCAGATGGGCCTAGG - Intergenic
1107963355 13:45578044-45578066 GGAAGTGCACAGATGGACCTAGG - Intronic
1107966194 13:45600313-45600335 GGAAGTGCACAGATGAATCTGGG - Intronic
1108700237 13:52937537-52937559 AAAAGAGCCCAGATGGACCTTGG + Intergenic
1108713645 13:53057974-53057996 GACAGTGCAGAGGGGGACCCTGG + Intergenic
1109627595 13:64995733-64995755 GGAAGTGCAAAGATGGGCCTAGG + Intergenic
1110611148 13:77489750-77489772 GAAAGTGCACAAATTGAAACTGG + Intergenic
1111101989 13:83599934-83599956 GAAAATGCAGAGAAGGGCCCGGG + Intergenic
1112278710 13:98044314-98044336 GCAAGTGCAGAGATGGGCCTAGG + Intergenic
1113660631 13:112104611-112104633 GAAAGGGCGCAGAGCGACCCTGG - Intergenic
1116189794 14:41649537-41649559 TGAAGTGCACAGATGGGCCTAGG - Intronic
1116381776 14:44277625-44277647 GAAAGTCCATAAATGGGCCCAGG - Intergenic
1118523236 14:66611019-66611041 GAAAGTGCACAGATGGGCCTAGG + Intronic
1119133715 14:72197449-72197471 GACAGTGGAAACATGGACCCAGG - Intronic
1119962078 14:78870178-78870200 GGAAGTGCACAGATGAGCCTAGG + Intronic
1121805420 14:96816033-96816055 GAAAATGTACAGAAGGAACCTGG + Intronic
1122231823 14:100309945-100309967 GAGAGTGCACAGAAGGGCTCTGG + Intergenic
1122397109 14:101441548-101441570 GACAGGGCCCAGAGGGACCCGGG - Intergenic
1122717185 14:103702769-103702791 GGACGTGCACAGATGGGCCTAGG - Intronic
1123940385 15:25213872-25213894 GAAAGCCCACAGAGGGAGCCTGG - Intergenic
1124068061 15:26364332-26364354 GCAAGTGCACTGCTGGAACCTGG + Intergenic
1126417253 15:48430605-48430627 GACAGTGGACAGAAGGAACCTGG - Intronic
1126901727 15:53321477-53321499 GGAAATGCACAGATGGGCCCAGG - Intergenic
1127829166 15:62735183-62735205 GAAATTTCACAGATGAAGCCTGG - Intronic
1128342196 15:66830388-66830410 GAAAGTGCAGAGCTGGAGTCAGG - Intergenic
1128820703 15:70650187-70650209 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1129141941 15:73606845-73606867 GGAAGTTCACAGATGGGCCTAGG - Intronic
1130079752 15:80722268-80722290 AAAAGTGAACAGATGGGCTCAGG + Intronic
1130440319 15:83946370-83946392 GAAAGCTCACAGTTGGACCAAGG - Intronic
1130557547 15:84933376-84933398 AAAAGTGGAGAGATGGGCCCAGG - Intronic
1131588061 15:93717506-93717528 AGAAGTGCACACATGGATCCAGG + Intergenic
1132205023 15:99980536-99980558 GAAACTGCACAGATGGATGGAGG + Intronic
1132644085 16:990836-990858 GGCAGTGCCCAGATGGGCCCAGG + Intergenic
1132955005 16:2587025-2587047 GTAAGTGCACAGTTGGAAACAGG + Intronic
1133456407 16:5946170-5946192 GAAAGTGCACAGACGGCCCGAGG + Intergenic
1133839210 16:9393733-9393755 GAAAGTGCAAAGAAGGCACCCGG + Intergenic
1134163786 16:11914999-11915021 GAATGAGGACAGATGGAGCCAGG - Intronic
1134207875 16:12252604-12252626 GAAAGGGCACTGATGGAACCGGG - Intronic
1134409557 16:13992745-13992767 GAAAGTGCAAAGTTGAAGCCTGG + Intergenic
1136298597 16:29318121-29318143 GAAAATGCACAGATGGGTGCAGG - Intergenic
1139381902 16:66537777-66537799 GAAAGTTCCCAGATGGATCCTGG - Intronic
1141644625 16:85360594-85360616 GGCAGTGCACAGCTGGGCCCGGG - Intergenic
1142025572 16:87811250-87811272 GAAAATGAATAGATGGGCCCGGG - Intergenic
1142025710 16:87812386-87812408 GAAAATGAACGGATGGGCCCGGG + Intergenic
1142643001 17:1295463-1295485 GAGAGAGCACAGAGAGACCCCGG - Intronic
1144220761 17:13097770-13097792 GAAAGCGCATAGATGGGCCTAGG + Intergenic
1144588201 17:16501747-16501769 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1146472489 17:33135596-33135618 GAAGGGGCAAAGATGGAGCCAGG + Intronic
1147685558 17:42284818-42284840 GTAAGTGCACAGATGGCACCAGG - Intergenic
1147930505 17:43977586-43977608 GAAAGTGGACAGAGGGACAAAGG - Intronic
1148770826 17:50064918-50064940 GAAAGGGCAGAGAGGGCCCCAGG + Intronic
1149460577 17:56826889-56826911 GCAAGTGCAGAGATGGAAGCAGG + Intronic
1149845323 17:60006182-60006204 GATAGGGCACAGAAGGACCCAGG - Intergenic
1150222532 17:63505212-63505234 GAAAGCCCCCAGATGGTCCCTGG + Intronic
1150306906 17:64093380-64093402 GAAACTGAACAGATGGGGCCAGG - Intronic
1151732539 17:75919998-75920020 GAGAGTGCACACAGGTACCCTGG - Exonic
1153002813 18:471907-471929 GAAAGTAGACAGAAGGCCCCTGG + Intronic
1153774122 18:8437820-8437842 GAGAGGGCATAGATGAACCCAGG + Intergenic
1153837918 18:8980985-8981007 GAAAGAGCACAGGAGGCCCCAGG + Intergenic
1156353403 18:36321262-36321284 ACAAGAGCACAGATGGGCCCTGG - Intronic
1156934717 18:42689782-42689804 AACAGTATACAGATGGACCCTGG - Intergenic
1157021611 18:43789471-43789493 TAATGTGCACAAATGGATCCAGG - Intergenic
1159429437 18:68332369-68332391 GAAAAGGCACAGATATACCCAGG + Intergenic
1159507452 18:69355785-69355807 GGAAATGCACAGATGGGCCTAGG - Intergenic
1159657206 18:71045759-71045781 GACAGTGCACATTTGGACCCAGG - Intergenic
1160508608 18:79441051-79441073 GGAACAGCACAGATGGCCCCTGG + Intronic
1160621040 18:80170842-80170864 GCAAGTGCACAGATTGGACCTGG - Exonic
1163217704 19:15893256-15893278 GACAGTTCACATAGGGACCCTGG + Intronic
1163333532 19:16657039-16657061 GATAGTGCAGGGATGGTCCCAGG - Intronic
1164531573 19:29052443-29052465 GTAAGTGCAAAGATGGATGCAGG + Intergenic
1165215796 19:34271541-34271563 GAAAGTGCACAGAAGGGGCCGGG - Intronic
1165232202 19:34394184-34394206 CAAGGAGCACAGATGGACCTTGG - Intronic
1165682763 19:37791545-37791567 TGAAGTGTACAGATGGGCCCAGG + Intronic
1165722152 19:38087097-38087119 GGAGGTGCACAGATGGGCCTAGG + Intronic
1167698293 19:51027434-51027456 GTAAGTGAACAGCTGGACTCGGG - Intronic
925068340 2:947746-947768 GAAAGGGCAAAGAAGGCCCCAGG + Intergenic
925299559 2:2800877-2800899 GAAAATGCACACATGCACCATGG - Intergenic
925731899 2:6925001-6925023 GAAAACTCACAGAAGGACCCAGG - Intronic
926758312 2:16253426-16253448 GAAAGTGCACTGTTGTAGCCTGG - Intergenic
927151958 2:20201332-20201354 GCAAATACACAGAGGGACCCTGG + Exonic
929947058 2:46379750-46379772 GAGAGTCCACAGATGGACCTGGG + Intronic
930273824 2:49288241-49288263 GGAAGTGCACAGATGGGCTTGGG + Intergenic
930570119 2:53075980-53076002 GAGAGTGTGCAGATGGGCCCTGG - Intergenic
930580836 2:53209907-53209929 GACAGTTCACAGAGGGAGCCAGG - Intergenic
931804042 2:65787743-65787765 GGAAGTGTACAGATGGACTTAGG - Intergenic
932601429 2:73129213-73129235 GGAAGTGCACAGGTGGGCCTAGG - Intronic
933284241 2:80367286-80367308 GAGAGTGCACAGATTCACCCAGG + Intronic
935736262 2:106108863-106108885 GGAAGTGCACAAATGGGCCTAGG - Intronic
936152133 2:110027708-110027730 GGAAGTGCAGAGATGGACAGGGG + Intergenic
936192545 2:110343705-110343727 GGAAGTGCAGAGATGGACAGGGG - Intergenic
938170420 2:129070708-129070730 GAATGTGGACACATGGACACTGG + Intergenic
938182874 2:129199543-129199565 GGAAGTACACAGATGGGCCTAGG - Intergenic
938337485 2:130512355-130512377 GGACGTGCACAGATGGACGTAGG - Intergenic
938352353 2:130608380-130608402 GGACGTGCACAGATGGACGTAGG + Intergenic
942377330 2:175351417-175351439 GAAACTTAACAGCTGGACCCTGG - Intergenic
944885446 2:204058179-204058201 AAAAGTGTAAAGGTGGACCCTGG + Intergenic
945067828 2:205961957-205961979 GAAAGTGCACAGACGGGCCTAGG - Intergenic
946232209 2:218298692-218298714 GTAAGGGCACAGCTGGAGCCTGG - Intronic
946402033 2:219473223-219473245 GGAAGTGTACAGATGGGCCAAGG - Intronic
946494739 2:220184476-220184498 GGAAGTACACAGATGGGCCTGGG - Intergenic
946507684 2:220318856-220318878 GAATGGGCAAAGATGGTCCCTGG + Intergenic
947167877 2:227280938-227280960 GAAGGTGCATAGAGGGTCCCAGG + Exonic
948433455 2:237935751-237935773 GGAAGTGCACAGAGGGGCCCAGG - Intergenic
948440439 2:237983794-237983816 GAAAGAGCACAGAGGGTCCAAGG - Intronic
948591430 2:239053261-239053283 GATCCTGAACAGATGGACCCGGG - Intronic
949042291 2:241854931-241854953 AACAATGCACAGATGGTCCCAGG - Intronic
1168952479 20:1811813-1811835 GAAAGTGCAGAGAAGCACACAGG + Intergenic
1169054055 20:2605434-2605456 GAAAGGTCACAGAAGGACACAGG - Intronic
1169276796 20:4238647-4238669 GCAAGTGCTCAGCTAGACCCTGG + Intronic
1170839994 20:19916903-19916925 TCAAATGCACAGATGGAGCCAGG - Intronic
1172437098 20:34937029-34937051 GAAAGAGCACAGGTGGCCCGAGG + Intronic
1173344815 20:42189231-42189253 GCAAGAGAACAGATTGACCCAGG - Intronic
1173447626 20:43134298-43134320 GGAAGTACACAGATGGGCCAAGG - Intronic
1173471857 20:43330178-43330200 AAAAGTCCAAAGAGGGACCCTGG - Intergenic
1177198161 21:17924456-17924478 GAAAGTGCACAGCTGCTCCATGG - Intronic
1177259295 21:18708303-18708325 GAAGGTGCCCTGATGGACCAGGG + Intergenic
1177297084 21:19189106-19189128 GAAGGTGCAGAGGTGGGCCCAGG + Intergenic
1177760226 21:25394924-25394946 GAAAGTGCACAGATAGGCCTCGG - Intergenic
1177851978 21:26359606-26359628 CAAAGAGAACACATGGACCCAGG + Intergenic
1179958405 21:44754081-44754103 GAAAGTCAAGAGATGGGCCCAGG + Intergenic
1183367595 22:37415402-37415424 GAAAGTGCACACACAGGCCCTGG + Intronic
1183472734 22:38018158-38018180 GAAAGTTCACAGATGAGCCCTGG - Intronic
1184910309 22:47527692-47527714 GAAAGCACACAGATGGGCCTAGG + Intergenic
1184910833 22:47532885-47532907 GGAAGTGCACAGATGGGGCTAGG + Intergenic
1185176961 22:49333357-49333379 GAAAGTGCACAGAGAAACCCAGG - Intergenic
1185405098 22:50643183-50643205 GGAAGTGCACAGATGGGCTCCGG - Intergenic
950924799 3:16729697-16729719 GGAAGTGCACAGATGGGCCCTGG + Intergenic
951591242 3:24267503-24267525 GGAAGTGCATAGATGAGCCCAGG - Intronic
952032098 3:29155525-29155547 GAAAGGGCACAAATGGAACAAGG - Intergenic
953898837 3:46826649-46826671 GGAAGTGCACAGACAGACCGAGG - Intergenic
954159889 3:48713467-48713489 GAATGTGCCCAGTTGGAACCTGG - Intronic
956706933 3:72007221-72007243 GGAAGTACACAGATGGGGCCAGG - Intergenic
957128666 3:76196064-76196086 GAAAAGGCACTGATGTACCCAGG - Intronic
957782252 3:84834626-84834648 GGAAGTGCAAAGGTGGACCTAGG + Intergenic
958441172 3:94157803-94157825 GAAAGTGCTCTGTTGGGCCCTGG + Intergenic
958979837 3:100708578-100708600 GAAGATGCACAGATGGTCCTAGG - Intergenic
959052904 3:101541361-101541383 AGAAGTGCACAGATGGGCTCAGG + Intergenic
959980902 3:112516552-112516574 GGAGGTGCACAGATGGGCCTAGG - Intergenic
960628010 3:119700529-119700551 GAAAGTACACAGACAGACCTAGG + Intergenic
961350217 3:126295701-126295723 GGAAGTGCACAGATGGGTCAAGG - Intergenic
962808818 3:138945440-138945462 GAAAAAGCACAGAGGGACCCTGG + Exonic
964345293 3:155749064-155749086 GAAAACGCACATATGGGCCCAGG + Intergenic
964828764 3:160859737-160859759 CAAAATGCACATATTGACCCAGG - Intronic
964885267 3:161474846-161474868 GAAAGAGCACAGATGGTGTCAGG + Intergenic
965463115 3:168993450-168993472 GGAAGTGCACAGATGGGCCTAGG - Intergenic
965681853 3:171259975-171259997 GGAAGTGCATAGATGGGCCTAGG - Intronic
965738489 3:171847908-171847930 GAAAGTACACAGATGGGCCTAGG + Intronic
966679029 3:182620528-182620550 GAAGGAGCCCAGATGGCCCCAGG - Intergenic
966891289 3:184409401-184409423 GCAAGTGGACGGAAGGACCCAGG + Intronic
966924596 3:184636082-184636104 GAGGGTTCACAGCTGGACCCAGG - Intronic
969229133 4:5817403-5817425 GAAAATTCCCAGATGGACTCTGG + Intronic
969527978 4:7713740-7713762 GGAAGTGCTCAGATGGGCCTAGG + Intronic
969689781 4:8698131-8698153 CAGTGTGGACAGATGGACCCGGG - Intergenic
969850072 4:9948970-9948992 GGAAGTACACAGATGGGCCTAGG - Intronic
970471931 4:16387590-16387612 GAAAGTGCATAGATGAGCCTAGG - Intergenic
970921945 4:21404948-21404970 GGAAGTGCACAGATAGGCCTAGG - Intronic
974561702 4:63531507-63531529 GAATGTGCACTGATGTAGCCAGG - Intergenic
976332979 4:83852960-83852982 GAAAGTGCACAGATGGGCCTAGG - Intergenic
976888539 4:90015672-90015694 GAAAGGTCACAGAAGGAACCAGG + Intergenic
977993679 4:103476422-103476444 GGAAGTGCACAGATGAACCTAGG + Intergenic
979129653 4:117026458-117026480 TGAAGTGCACAAATGGGCCCAGG + Intergenic
979689200 4:123542829-123542851 GGAAGTGCACAGATGGGCCTAGG - Intergenic
980197090 4:129603309-129603331 GCAAGTTCACAGATGGTCCTAGG - Intergenic
980218102 4:129877564-129877586 GAGACTGCACAGTTGGAACCTGG + Intergenic
981791423 4:148541141-148541163 AGAAGTACACAGTTGGACCCAGG - Intergenic
982304370 4:153914677-153914699 GAAAATTCACAGAGGAACCCTGG - Intergenic
982412115 4:155090119-155090141 GAAAGTGTGGAGACGGACCCTGG - Intergenic
982547277 4:156749546-156749568 GAAAGTGCAAAGGTGGAGTCAGG + Intergenic
983426401 4:167589205-167589227 GGAAGTGCACATATGGACTTAGG + Intergenic
984719882 4:182959638-182959660 GGAAGTACACAGATGGGCCTAGG + Intergenic
986247895 5:6027922-6027944 GAAAGGGCAGTGGTGGACCCTGG - Intergenic
986383792 5:7211183-7211205 AAAAGTGCACAGTTACACCCAGG + Intergenic
986613679 5:9594720-9594742 GGAAGTGCACAGATGGGCCCAGG + Intergenic
987027523 5:13942500-13942522 GGAAGTGTACAGATGGGCCTAGG - Intronic
987077425 5:14397174-14397196 GAAACTGCATAGATGCACACTGG - Intronic
987259786 5:16191804-16191826 GGAAGTGCACAGATGGGCATAGG - Intergenic
987683463 5:21166463-21166485 AAGAGTGCACAAATGGACCTAGG - Intergenic
989941180 5:50151669-50151691 GAATGAGAACAGATGGACACAGG + Intergenic
991257811 5:64634351-64634373 GGAAGTACACAGATGGGCCTAGG + Intergenic
992634913 5:78718111-78718133 GCAGGTGCACAGTTGGAACCTGG + Intronic
993953365 5:94202098-94202120 GGAAGTGCACAGATGGACCTAGG + Intronic
994116386 5:96065867-96065889 GAAAGAGCACATATTGTCCCTGG + Intergenic
994865798 5:105268103-105268125 GGAAGTGCACAGATGAACGTTGG - Intergenic
999170203 5:149587841-149587863 GAATGTGCACATAGGGACCCTGG - Intronic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1001782960 5:174386189-174386211 GGAAGGGGACAGATGGACTCAGG + Intergenic
1002130168 5:177076365-177076387 GGAAGTGCACAGATGGACCTAGG - Intronic
1005214960 6:23515145-23515167 GGAAGTGCACAGATGGACCTAGG - Intergenic
1005577635 6:27205077-27205099 GGAAGAACACAGATGGGCCCTGG - Intergenic
1006387646 6:33740287-33740309 GGAAGTGGACAGATGGCCCCAGG + Intronic
1007194079 6:40044927-40044949 GAAAATGAACACATGGACACAGG + Intergenic
1007565894 6:42850098-42850120 GTAAGTGCTCACATAGACCCTGG - Intronic
1007712839 6:43835660-43835682 GAAAGAGCACTGCTTGACCCAGG + Intergenic
1008157195 6:48031086-48031108 GAAAGTGCACAGATTAGCCTAGG - Intronic
1009622895 6:66098277-66098299 GGAAGTGCACAGATGGGACGAGG + Intergenic
1010004816 6:70984102-70984124 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1010427540 6:75743748-75743770 GGAAGGACACAGATGGACCTAGG + Intergenic
1010508829 6:76692154-76692176 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1014573877 6:123045786-123045808 GCAAGTGCAGTGATGGACCCAGG + Intronic
1015606468 6:134960873-134960895 GAAAGGGCACAGATGTACTGGGG - Exonic
1015978878 6:138818932-138818954 GGAAGTGCACAGGTGGGCCAAGG + Intronic
1015996402 6:138999260-138999282 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1016443541 6:144109343-144109365 GGAAGTGCACAGATGGGCCCAGG + Intergenic
1017290523 6:152730277-152730299 GAAAGTCCAAATCTGGACCCAGG + Intergenic
1017644441 6:156526246-156526268 CAATGTGAACACATGGACCCAGG - Intergenic
1019070600 6:169341833-169341855 GAGGGTGCACAGATGGAGCCGGG - Intergenic
1021809560 7:24390158-24390180 GCAAGTACAAAGATGGACCAAGG - Intergenic
1022378841 7:29841029-29841051 GGGAGTGCACAGATGGGCCTGGG + Intronic
1025963449 7:66245569-66245591 AGAAGTGCACAGATGGTCCTAGG + Intronic
1027449509 7:78314607-78314629 GCATGTGCACACATGGCCCCTGG + Intronic
1027671585 7:81105903-81105925 GAATGTGTACAGATGGGCCTAGG + Intergenic
1028137017 7:87232618-87232640 GGAAGTGCACAGATGAGCCTAGG + Intergenic
1028859606 7:95633926-95633948 GAAAGAGCATAGATGAACACAGG + Intergenic
1029549821 7:101231847-101231869 GAAATAGCAGAGATGGCCCCTGG - Intergenic
1030785057 7:113650030-113650052 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1032090552 7:128909644-128909666 GAAGGGGCACAGATGGAGGCAGG - Intronic
1033991048 7:147287422-147287444 GGAATTGCACAGATGGGCCTTGG + Intronic
1034937718 7:155210495-155210517 GAGAGTGTTCATATGGACCCAGG - Intergenic
1035370154 7:158374667-158374689 GCAAGTGGACAGATGGAGGCTGG + Intronic
1036151690 8:6305074-6305096 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1036723371 8:11199615-11199637 AAGAGGGCACAGATGTACCCAGG + Intronic
1036744905 8:11399875-11399897 GAAAGTACACAGATGAGCCTTGG + Intronic
1039733920 8:40309549-40309571 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1039734246 8:40313877-40313899 GAAAGTGCACAGATGGGCCTAGG - Intergenic
1041322331 8:56626168-56626190 GGAAGTGCAAAGATGGGCCTAGG - Intergenic
1041511746 8:58660404-58660426 GGAAGTGCACACAAGGACCTGGG + Intergenic
1041935231 8:63325612-63325634 GAAGTTGCAGAAATGGACCCTGG + Intergenic
1042206798 8:66337724-66337746 GGAAGTGCACAGTTGGGCCTAGG - Intergenic
1042752190 8:72170331-72170353 GCAAGTGCAAACATGGACACTGG - Intergenic
1042987756 8:74603219-74603241 GAAACTACACAGATGGATCATGG + Intronic
1043342277 8:79254674-79254696 AGAAGTGCATAGATGGGCCCAGG + Intergenic
1044510323 8:93069947-93069969 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1045473832 8:102536846-102536868 GAAACTGCACAAATTAACCCTGG + Intronic
1047441799 8:124885239-124885261 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1047757241 8:127928084-127928106 GGAAGTACACAGATGGGCCTAGG - Intergenic
1049390549 8:142367495-142367517 GAAAGCAGACAGATGGACGCCGG + Intronic
1051464397 9:17360610-17360632 GGAAGTGCACAGATGGGCTTAGG + Intronic
1051775991 9:20634621-20634643 GGAAGTGCACAAATGGGCCTAGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053537185 9:38937619-38937641 GGAAGTGCACAGATGGGCCTTGG + Intergenic
1054628950 9:67426311-67426333 GGAAGTGCACAGATGGGCCTTGG - Intergenic
1056297152 9:85204733-85204755 AAAAGTGCACAGAGGGAGACAGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056699347 9:88889118-88889140 GGAAGTGCTCAGATGTCCCCTGG - Intergenic
1057191920 9:93093206-93093228 GGAAGTTCACAGATGGGCCAAGG - Intergenic
1057630334 9:96714913-96714935 GCAAGTGCACAGATGTGCCTAGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1059306912 9:113360907-113360929 TGAAGTGCACAGATGGGCCTGGG - Intronic
1059346715 9:113633982-113634004 GCAGGAGCACAGATGGTCCCTGG + Intergenic
1059669209 9:116477292-116477314 CAAAGTGCACAGTTGGGGCCTGG - Intronic
1059747943 9:117220881-117220903 GAAAATGCAGAGATGTTCCCTGG - Intronic
1060417237 9:123440008-123440030 GAAGGTGCAAAGAAGGGCCCGGG + Intronic
1061027812 9:128061885-128061907 GAAAGTGTAAAGATGGAACAGGG + Exonic
1061494459 9:130963756-130963778 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1061954288 9:133953568-133953590 CAAAGTCCCCAGAGGGACCCTGG + Intronic
1062348550 9:136127304-136127326 GAAAAGACACAGAGGGACCCAGG - Intergenic
1186550248 X:10497328-10497350 GAAAGTGCGCAGAAGGGCCCAGG - Intronic
1186637516 X:11422356-11422378 GAAAGGGCACAGATGTGGCCAGG + Intronic
1187052374 X:15707615-15707637 GAAAGGGCACAAATTGCCCCAGG + Intronic
1187945188 X:24419449-24419471 GAAAGTGTGCAGATGGGACCTGG - Intergenic
1190110204 X:47584427-47584449 GGAAGTGCACAGATGGGCCTAGG + Intronic
1190379748 X:49828418-49828440 GGAAATGCACAGATGGGCCTAGG + Intergenic
1190412630 X:50152009-50152031 CAAAGAGAACAGATGGACACAGG + Intergenic
1191895240 X:65985876-65985898 GAAAGGGCAAAGAGGGACACTGG + Intergenic
1192614242 X:72601628-72601650 GGAAGTGCACAAATGGGCCTAGG + Intronic
1192856158 X:75014414-75014436 GAATGAGAACACATGGACCCAGG - Intergenic
1193165574 X:78276810-78276832 GAAAGTGGACAGATGGAGGATGG + Intronic
1194688450 X:96953696-96953718 GGAAGAGAAGAGATGGACCCTGG - Intronic
1194773908 X:97939275-97939297 GAAATTGCACAGATGGAGAGGGG - Intergenic
1196078152 X:111600341-111600363 GAAAGTACACATATGGGCCAAGG - Intergenic
1198227490 X:134659002-134659024 GAATGAGAACACATGGACCCAGG + Intronic
1198505020 X:137292849-137292871 GAAAGTGCACAGATGAGCCAAGG + Intergenic
1199467577 X:148156585-148156607 GAAAGTGAACAGATGTAACCAGG + Intergenic
1201358328 Y:13119133-13119155 CAAAGAGAACAGATGGACACAGG - Intergenic
1201589648 Y:15601036-15601058 GGAAGTGCACAGATGGGCCTGGG - Intergenic