ID: 922820227

View in Genome Browser
Species Human (GRCh38)
Location 1:228479487-228479509
Sequence CAGTGTGAGCCCTGGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922820227_922820233 20 Left 922820227 1:228479487-228479509 CCAGGCTCCCAGGGCTCACACTG No data
Right 922820233 1:228479530-228479552 CTTGCAGTCTCAGGAGCCACAGG No data
922820227_922820232 11 Left 922820227 1:228479487-228479509 CCAGGCTCCCAGGGCTCACACTG No data
Right 922820232 1:228479521-228479543 CAGGCTGCACTTGCAGTCTCAGG No data
922820227_922820230 -8 Left 922820227 1:228479487-228479509 CCAGGCTCCCAGGGCTCACACTG No data
Right 922820230 1:228479502-228479524 TCACACTGCCTGACAGTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922820227 Original CRISPR CAGTGTGAGCCCTGGGAGCC TGG (reversed) Intergenic
No off target data available for this crispr