ID: 922821285

View in Genome Browser
Species Human (GRCh38)
Location 1:228487470-228487492
Sequence GGCCCCGCCGCCCGCAGCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 821
Summary {0: 1, 1: 1, 2: 17, 3: 111, 4: 691}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922821278_922821285 0 Left 922821278 1:228487447-228487469 CCAGCCGCTCCTGCGCCCTTGCC 0: 1
1: 0
2: 1
3: 25
4: 342
Right 922821285 1:228487470-228487492 GGCCCCGCCGCCCGCAGCCCTGG 0: 1
1: 1
2: 17
3: 111
4: 691
922821281_922821285 -9 Left 922821281 1:228487456-228487478 CCTGCGCCCTTGCCGGCCCCGCC 0: 1
1: 0
2: 4
3: 74
4: 568
Right 922821285 1:228487470-228487492 GGCCCCGCCGCCCGCAGCCCTGG 0: 1
1: 1
2: 17
3: 111
4: 691
922821275_922821285 5 Left 922821275 1:228487442-228487464 CCTCCCCAGCCGCTCCTGCGCCC 0: 1
1: 0
2: 4
3: 90
4: 813
Right 922821285 1:228487470-228487492 GGCCCCGCCGCCCGCAGCCCTGG 0: 1
1: 1
2: 17
3: 111
4: 691
922821276_922821285 2 Left 922821276 1:228487445-228487467 CCCCAGCCGCTCCTGCGCCCTTG 0: 1
1: 1
2: 1
3: 19
4: 291
Right 922821285 1:228487470-228487492 GGCCCCGCCGCCCGCAGCCCTGG 0: 1
1: 1
2: 17
3: 111
4: 691
922821272_922821285 22 Left 922821272 1:228487425-228487447 CCGTCTAGGTCTCCGGCCCTCCC 0: 1
1: 0
2: 0
3: 16
4: 188
Right 922821285 1:228487470-228487492 GGCCCCGCCGCCCGCAGCCCTGG 0: 1
1: 1
2: 17
3: 111
4: 691
922821277_922821285 1 Left 922821277 1:228487446-228487468 CCCAGCCGCTCCTGCGCCCTTGC 0: 1
1: 0
2: 1
3: 13
4: 151
Right 922821285 1:228487470-228487492 GGCCCCGCCGCCCGCAGCCCTGG 0: 1
1: 1
2: 17
3: 111
4: 691
922821280_922821285 -4 Left 922821280 1:228487451-228487473 CCGCTCCTGCGCCCTTGCCGGCC 0: 1
1: 0
2: 3
3: 15
4: 253
Right 922821285 1:228487470-228487492 GGCCCCGCCGCCCGCAGCCCTGG 0: 1
1: 1
2: 17
3: 111
4: 691
922821274_922821285 6 Left 922821274 1:228487441-228487463 CCCTCCCCAGCCGCTCCTGCGCC 0: 1
1: 0
2: 6
3: 78
4: 640
Right 922821285 1:228487470-228487492 GGCCCCGCCGCCCGCAGCCCTGG 0: 1
1: 1
2: 17
3: 111
4: 691
922821273_922821285 10 Left 922821273 1:228487437-228487459 CCGGCCCTCCCCAGCCGCTCCTG 0: 1
1: 0
2: 9
3: 103
4: 1019
Right 922821285 1:228487470-228487492 GGCCCCGCCGCCCGCAGCCCTGG 0: 1
1: 1
2: 17
3: 111
4: 691
922821271_922821285 26 Left 922821271 1:228487421-228487443 CCGGCCGTCTAGGTCTCCGGCCC 0: 1
1: 0
2: 0
3: 2
4: 78
Right 922821285 1:228487470-228487492 GGCCCCGCCGCCCGCAGCCCTGG 0: 1
1: 1
2: 17
3: 111
4: 691

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922821285 Original CRISPR GGCCCCGCCGCCCGCAGCCC TGG Exonic
900091747 1:923864-923886 GCCCGCGCCGCCCGCCGCGCCGG + Intergenic
900148675 1:1168960-1168982 GGCCCCGCAGACACCAGCCCAGG + Intergenic
900214094 1:1471964-1471986 GTCCCCGCCGCCCTCGGCCCCGG - Exonic
900221643 1:1512348-1512370 GTCCCCGCCGCCCTCGGCCCCGG - Exonic
900255031 1:1693425-1693447 GGCCCCGCCCCCCGCAGCTCCGG - Intronic
900257421 1:1704371-1704393 GACCCGGCCGCCCCAAGCCCAGG + Intronic
900263774 1:1746691-1746713 GGCCCCGCCCCCCGCAGCTCCGG - Intergenic
900271777 1:1793886-1793908 GGCCTCGCCGCCTCCTGCCCTGG - Intronic
900313312 1:2045024-2045046 CGCGCGGCCGCCAGCAGCCCGGG + Intergenic
900364798 1:2306722-2306744 GCCCTCGCTGCCCGCAGCCTCGG - Exonic
900370729 1:2331046-2331068 GTGCCCGCCGCCTGCTGCCCTGG - Intronic
900394185 1:2446397-2446419 GGCCACCCCACCCCCAGCCCCGG - Intronic
900414008 1:2526778-2526800 CGCCCGCCCGCCCGCAGCCCCGG - Intergenic
900432764 1:2610819-2610841 GGCCCCCCAGCCCCCAGCACGGG + Intronic
900585345 1:3429953-3429975 GGCACTGCCTCCCGCTGCCCTGG - Intronic
900907077 1:5566901-5566923 GGCCCGGCTGCCCAAAGCCCTGG - Intergenic
901045630 1:6393855-6393877 GGCCCCACTGCCAGGAGCCCGGG - Intronic
901086713 1:6615129-6615151 GCCCACGCCGCCCGCCCCCCCGG - Intronic
901212453 1:7534277-7534299 AGCCCCGCGGCCCCCAGCCTCGG - Intronic
901433889 1:9234741-9234763 GCCCCCGCCGCGCGCGCCCCCGG + Intergenic
901691178 1:10974152-10974174 GGCAGCCCGGCCCGCAGCCCTGG - Intronic
901762403 1:11479516-11479538 GGCTCCGAGGCCCGCATCCCGGG - Intronic
901791285 1:11654812-11654834 CGCCCCGCCCCGCGCAGCGCTGG - Intronic
901859125 1:12063177-12063199 GCCTCCGCTCCCCGCAGCCCAGG + Intergenic
902350332 1:15848862-15848884 AGCCCCGGCGCCCGTAGCCTCGG + Intronic
902385535 1:16073514-16073536 GGCTCCGCAGCGCTCAGCCCCGG - Exonic
902681767 1:18048815-18048837 GCCCCCACCTCCCCCAGCCCTGG + Intergenic
903349833 1:22710949-22710971 GGCGCCGCGGCCCGAGGCCCCGG + Exonic
903415201 1:23177693-23177715 TCCCCCGCCGCCCGCAAGCCTGG - Exonic
903459438 1:23510098-23510120 GGCCCCACCGCCTCCATCCCTGG - Exonic
903573269 1:24321923-24321945 GGCGCCCTCGGCCGCAGCCCAGG - Intronic
903652611 1:24930686-24930708 GACCCCGCGGCCCCCAGCCCGGG - Intronic
903750395 1:25617445-25617467 GGTCCCGGCGGCCGCAGCGCGGG + Intergenic
903925194 1:26826843-26826865 CGCCCCGCTGCCCGCCTCCCCGG + Exonic
903986898 1:27234996-27235018 GGGACCGGCTCCCGCAGCCCCGG + Intronic
904162287 1:28530710-28530732 GGCCCCCCAACCCGCAGCCCCGG - Intronic
904211031 1:28887189-28887211 GTCCCCGCCGCACCCAGCCCAGG + Exonic
904751221 1:32742205-32742227 CGCCCCCCCGCGCTCAGCCCAGG - Intronic
904753221 1:32754018-32754040 GGCCGCCGGGCCCGCAGCCCCGG - Intronic
905202160 1:36322613-36322635 GGGCGCCCCGCCCGCGGCCCCGG - Exonic
905414363 1:37794341-37794363 GGCCCCCGCGCCCGCTGCCAGGG + Exonic
905584302 1:39105219-39105241 GGCCCAGCCGGCCGCAGCCTGGG + Intronic
906109602 1:43313774-43313796 GGGCCCTCAGCCTGCAGCCCTGG - Exonic
906662542 1:47593270-47593292 CGGCCCGCCGCCGCCAGCCCGGG + Intergenic
906840592 1:49134474-49134496 GGCCCCCCCCCCCCCACCCCAGG + Intronic
907051094 1:51330393-51330415 GCCCGCGCCGCCCGCGCCCCCGG + Intronic
907223019 1:52921242-52921264 GGCCCCGCGGCCCCCAGGCCAGG - Intronic
907678152 1:56537805-56537827 GGCCCTGCTGCCTGCAGACCTGG + Intronic
908195350 1:61742351-61742373 GAGCCCGCCTCCCGCGGCCCCGG + Intergenic
908794281 1:67815986-67816008 GCCCCGGCCGCACCCAGCCCTGG - Intronic
911115031 1:94237667-94237689 GGCCCCGCCCCCGGGAGCGCGGG - Intronic
912494820 1:110084582-110084604 GGCTCCGCTCCCCGCAGGCCTGG - Intergenic
912549052 1:110472750-110472772 GGTCCCGCCGGCGGCTGCCCAGG + Intergenic
912798547 1:112707045-112707067 CGCCCCACCGCCCGCAGCCCCGG + Intronic
912993426 1:114510897-114510919 GGCCGCGCCGCCCTCAGCGCCGG + Exonic
914702735 1:150149664-150149686 GACCCGGCCGCCGGCCGCCCCGG - Intronic
914803275 1:150975119-150975141 GACACCGCCGCTCGGAGCCCGGG - Intergenic
915238481 1:154502496-154502518 CACCCCGCCGCCCCCAGCTCTGG - Intronic
915355004 1:155250633-155250655 GGCCCCGCAGGCCACAGTCCAGG + Exonic
915559187 1:156676628-156676650 GGCCCAGCCGCTCGCGGGCCTGG + Exonic
915896311 1:159813753-159813775 TGCCCCGTCTCCTGCAGCCCTGG - Intronic
916101893 1:161399919-161399941 GACCCCGCCGCGAGCAGCCCGGG - Intergenic
916651681 1:166839647-166839669 GGCCCAGCCGCCCGGGACCCGGG - Intronic
918058970 1:181045853-181045875 GCAAGCGCCGCCCGCAGCCCGGG - Intronic
918064276 1:181089116-181089138 GGCCCGGCCGCCGGCTCCCCGGG - Exonic
918093668 1:181317621-181317643 CCGCCCGCCGCCCCCAGCCCCGG + Intergenic
919091976 1:192987315-192987337 GGCAGCTCCACCCGCAGCCCTGG + Intergenic
920351914 1:205343397-205343419 GCCCCGGCTGCCCACAGCCCGGG - Exonic
922476708 1:225911533-225911555 GTCCCGGCCGCCCGCGGCCGAGG - Intronic
922481840 1:225944753-225944775 GGCCTGGCCTCCCTCAGCCCTGG - Intergenic
922821285 1:228487470-228487492 GGCCCCGCCGCCCGCAGCCCTGG + Exonic
922925151 1:229342204-229342226 GCCCCCGCCGCCCGTAGAGCCGG - Exonic
922958494 1:229625648-229625670 CACGCCGCCGGCCGCAGCCCGGG + Intronic
922985948 1:229865862-229865884 GGCAGCTCCACCCGCAGCCCTGG + Intergenic
923008003 1:230067375-230067397 GGCGCCGCCGCCCGCGCCCCCGG - Exonic
923055887 1:230425908-230425930 GCCCCCGCCGCCCTCGGCCATGG + Intergenic
923630923 1:235649371-235649393 GGACCGGGCGCCCCCAGCCCCGG + Intronic
924775503 1:247112446-247112468 GGCCCCGCCGGCCTGAGTCCTGG + Intergenic
1063848779 10:10161299-10161321 GGCAGCTCCGCCTGCAGCCCTGG + Intergenic
1064060101 10:12129845-12129867 AGCCCCACCGCCCGCAGCCCAGG - Intronic
1065099558 10:22320727-22320749 GGCCCCGCGGGCTGCGGCCCAGG - Intronic
1065214992 10:23439904-23439926 CGCCCCGGCGCCCGCAGCCCCGG + Exonic
1065928581 10:30458252-30458274 CCCCCCGCCGCCCCCAGCCCTGG - Intronic
1065993046 10:31031638-31031660 GGCCTCGCCTCCCGCACCCCAGG + Intronic
1066180544 10:32957808-32957830 GGCCCGGTCCCCCGCAGCTCCGG + Exonic
1066613542 10:37275280-37275302 GGCAGCTCCGCCCACAGCCCTGG - Intronic
1066614996 10:37285122-37285144 GGCAGCTCCGCCCGCAGCCCTGG - Intronic
1067113953 10:43420560-43420582 CGCCCCGCCGCCGGCAGCGCTGG - Intergenic
1067369783 10:45672619-45672641 GGCTCAGCGGCTCGCAGCCCGGG + Intronic
1067450633 10:46380013-46380035 GACCCCTCCGCTCACAGCCCTGG + Intronic
1067586610 10:47479738-47479760 GACCCCTCCGCTCACAGCCCTGG - Intronic
1067945290 10:50685095-50685117 GGCCGGGCAGCCCTCAGCCCAGG - Intergenic
1068566937 10:58586523-58586545 CGCCCCCCCGCCCCCAACCCCGG - Intronic
1068877415 10:62011572-62011594 GGCCCCGCCACTCCCAACCCTGG + Intronic
1068955359 10:62815617-62815639 CGCCCCGGCGCGCCCAGCCCCGG - Intronic
1069639060 10:69943471-69943493 GGCTCCAGCGCCCCCAGCCCCGG + Intronic
1069738475 10:70672734-70672756 AGCCTCGCCGCCCTCAGCCTGGG + Intergenic
1069766217 10:70862067-70862089 GGCAGCTCCACCCGCAGCCCCGG + Intronic
1069962811 10:72088298-72088320 GCACCAGCCGCCCGCAGCCCGGG + Exonic
1070147509 10:73785759-73785781 GCCCCGGCCACCCCCAGCCCCGG + Exonic
1070866801 10:79711967-79711989 GGCCAGGCAGCCCTCAGCCCAGG - Exonic
1070880590 10:79850088-79850110 GGCCGGGCAGCCCTCAGCCCAGG - Exonic
1071633712 10:87234190-87234212 GGCCGGGCAGCCCTCAGCCCAGG - Exonic
1071647160 10:87366406-87366428 GGCCGGGCAGCCCTCAGCCCAGG - Exonic
1071715251 10:88089135-88089157 GGCACCGCCGCCTGCCGCCCCGG + Intergenic
1072970039 10:100009755-100009777 GTCCCCTCCGCCCGCGGCCCCGG + Intronic
1073251128 10:102120802-102120824 GGCTCCGCCTCCCCCAGCCGCGG - Intergenic
1073432332 10:103494432-103494454 GGCCCCGCGGCGCGCGGCTCGGG - Exonic
1074081370 10:110170537-110170559 GCCCCCGCCCCCCCCACCCCTGG + Intergenic
1075492065 10:122879906-122879928 GGCCCCGCCTGCGGCATCCCAGG - Intergenic
1076000095 10:126906591-126906613 GGTCTCGCCTCCCACAGCCCAGG + Intronic
1076020205 10:127066210-127066232 GCCCCCGCCGCCCCCAGCTGCGG + Intronic
1076417202 10:130300578-130300600 GGCCCCGGGGCCCGCATGCCGGG + Intergenic
1076594542 10:131617672-131617694 GGCCCAGCCTCTCGCAGCCCAGG + Intergenic
1076657862 10:132036600-132036622 CGCCCCGCCGCCCCCACTCCCGG - Intergenic
1076707249 10:132308483-132308505 ATTCCCGCCGCCCGCATCCCGGG - Intronic
1076722150 10:132397402-132397424 GCCTCCGCCGCCCGGAGACCCGG + Intronic
1076792812 10:132785950-132785972 GGCGCCGCCGCCGCCGGCCCGGG + Exonic
1076880070 10:133235737-133235759 CTCCCCGCCTCCTGCAGCCCGGG - Intergenic
1077040423 11:518753-518775 GGCCCCGTCGTGGGCAGCCCGGG - Intergenic
1077106712 11:845413-845435 GGCCCCACCGCTCACAGCGCCGG - Intronic
1077183916 11:1228182-1228204 GGCCCCGCAGCCGGCAGCCCTGG + Intronic
1077218992 11:1407097-1407119 GGCCCCACCCTCGGCAGCCCAGG - Intronic
1077249401 11:1554365-1554387 TGGCCCGCCTCCCGCAGCACTGG + Exonic
1077316040 11:1919787-1919809 GGCCCCGTCGGCCCCAGTCCTGG - Intronic
1077322055 11:1947034-1947056 GGCCCCACAGCCTGAAGCCCGGG - Intergenic
1077326959 11:1968125-1968147 GGCCCCTCAGCCCCCAGCCAGGG + Intronic
1077404510 11:2377198-2377220 GGCCCCGCCTCCTGCCGCCAGGG - Intronic
1077408173 11:2391839-2391861 GGCTCTGCCACCCACAGCCCAGG - Intronic
1077582076 11:3423109-3423131 GGCCCCGCCTCCCGGACCCTGGG - Intergenic
1078246110 11:9574171-9574193 GGGCCGGCCCCCGGCAGCCCCGG + Exonic
1078317766 11:10306512-10306534 GGCGCCGGCGGCCGTAGCCCTGG - Exonic
1079136072 11:17776654-17776676 GGCCCTGCCTCCCCCAGCCCAGG - Intronic
1079555138 11:21751367-21751389 TGCCCCCCCGCCCCCAGCTCTGG + Intergenic
1081636891 11:44727349-44727371 GACCCCCCCGCGCGCCGCCCCGG + Intronic
1081807150 11:45896846-45896868 GGCCCCGCAGCCCCCCGGCCGGG + Intronic
1081831513 11:46119974-46119996 GCCCCCGCCGCCGGCGGCCGCGG - Intronic
1081846391 11:46243499-46243521 GGCCCCGCCCCCCGCACATCTGG - Intergenic
1081869123 11:46375377-46375399 GACCCCCCTGCCCCCAGCCCTGG + Intronic
1081872996 11:46391684-46391706 GGCCCGGCCGCCCGCCCCGCCGG - Intergenic
1082784965 11:57311661-57311683 AGCCCCGCCCCTTGCAGCCCAGG + Intronic
1082833854 11:57638484-57638506 CGCCCCGCCACCCGCCGGCCGGG - Intergenic
1082924692 11:58532349-58532371 GGCAGCTCCGCCCGCAGCCCTGG + Intronic
1082986124 11:59172466-59172488 TGCCCCGCGCCCCGCCGCCCCGG - Intronic
1083169518 11:60914590-60914612 GGCCCAGCCTCCTGCAGCCTCGG + Intronic
1083171177 11:60924752-60924774 GGCCCGGCCGCCCCTCGCCCCGG - Intronic
1083182557 11:60996533-60996555 GGGCCCGCCTCCCGAGGCCCTGG - Intronic
1083329768 11:61891912-61891934 GGCCCCGCTGCTCACAGACCGGG - Intronic
1083560626 11:63670918-63670940 GGCCCCGCCGAGCCCCGCCCTGG - Intronic
1083571246 11:63763280-63763302 GGCCGCGCCCCCCGCTGGCCGGG - Exonic
1083572663 11:63768646-63768668 GGCCCCGCGCCCCGCCGCCCCGG - Exonic
1083618290 11:64036790-64036812 GTGCCCGCCGCCCCCCGCCCAGG - Intronic
1083669514 11:64292229-64292251 GGCGCCGCCGCCCGCTGTCTCGG + Intronic
1083758749 11:64804720-64804742 GGCCCCGCCGCCGGCCTTCCCGG + Exonic
1083822566 11:65181499-65181521 GGCGCCGCCTCCCGCAGCCCCGG - Exonic
1083993898 11:66262804-66262826 GGCCCTGCAGCCCCTAGCCCAGG + Exonic
1084021317 11:66419994-66420016 GGCCCCGCCCGCCGCAGCCGCGG + Intergenic
1084444629 11:69196495-69196517 GGCCCCTCCGCCGGCCGCCTGGG - Intergenic
1084501950 11:69540269-69540291 GGCCCAGCTGCCCGCTGGCCCGG + Intergenic
1084672692 11:70616521-70616543 GGCCCTGCCTCCCTCATCCCTGG - Intronic
1084711939 11:70849020-70849042 GGCCCTGCAGCCAGCATCCCTGG - Intronic
1084833439 11:71786914-71786936 GGCCCCGCCTCCCGGACCCTGGG + Intergenic
1084888127 11:72223836-72223858 CGCCCCGCCCCGCGCCGCCCCGG - Intronic
1085266246 11:75239880-75239902 AGCCCCCCCACCCTCAGCCCTGG + Intergenic
1085296184 11:75433104-75433126 GTGCCTGCCGCCCGCACCCCTGG + Intergenic
1085332776 11:75667574-75667596 GACGCCGCTGCCCGCGGCCCAGG - Exonic
1085477904 11:76799290-76799312 TGCCCTGCACCCCGCAGCCCTGG + Intergenic
1087172814 11:95067580-95067602 GGCTCCGCCGCCCGTAGCTGCGG - Exonic
1089556262 11:119317255-119317277 GGCCCCGGCGCCGCCAGCCCGGG + Intronic
1089566036 11:119372346-119372368 GGCCCCCCCGCATCCAGCCCAGG + Intronic
1090818131 11:130315907-130315929 GGCGCTGCCGCCTGCAGTCCCGG - Intergenic
1202805071 11_KI270721v1_random:2347-2369 GGCCCCACAGCCTGAAGCCCGGG - Intergenic
1202809941 11_KI270721v1_random:23305-23327 GGCCCCTCAGCCCCCAGCCAGGG + Intergenic
1091381872 12:67101-67123 GGCCCCGCTGCCGGCCGCTCCGG + Exonic
1091597082 12:1885393-1885415 CAGCCCGCAGCCCGCAGCCCAGG + Intronic
1091718564 12:2795955-2795977 CGCCCCACACCCCGCAGCCCTGG - Intronic
1091759351 12:3077106-3077128 CGCCCCGCCGCCCGCATGCCCGG - Intergenic
1091759480 12:3077464-3077486 CGCCTCGCCGCCCGCCGCCCGGG - Intronic
1092230299 12:6772442-6772464 CGGCCCGCCCCCCGCACCCCAGG - Intergenic
1092253527 12:6914535-6914557 GCCTCCTCCGCCCGCCGCCCGGG + Intronic
1092409458 12:8242835-8242857 CGCCCCGCCGCCCACATGCCAGG + Intergenic
1093164365 12:15788904-15788926 TGCCCAGCCTCCCGGAGCCCTGG + Intronic
1094000221 12:25686659-25686681 GGCAGCTCTGCCCGCAGCCCTGG + Intergenic
1096004329 12:48157055-48157077 GGCCCCGCCCCCTCCCGCCCCGG + Intronic
1096102592 12:48978707-48978729 GGCCGCTCTGCCCGCAGCCCTGG + Exonic
1096389400 12:51217475-51217497 GGCCCAGCATCCCGCCGCCCCGG + Intronic
1096475731 12:51907666-51907688 CGCCCCGCCACCCGCAGAGCGGG + Exonic
1096674888 12:53221113-53221135 GGCCCCGCCCCACCCCGCCCAGG + Intronic
1097166445 12:57088934-57088956 GGCCCCAGCGCCCGCCTCCCCGG + Exonic
1097182860 12:57180861-57180883 GGCCCTGCAGCCTGCAGCTCTGG - Intronic
1098161037 12:67648640-67648662 GGCCCCGCCCCCGGCTCCCCCGG - Intronic
1099973810 12:89525818-89525840 GGCCCCGCAGCCCGCGGGACAGG + Intronic
1099989550 12:89708551-89708573 TGCCCCGCCGCCCCCGGCCGCGG + Intronic
1100611582 12:96195051-96195073 GGCCCCGCTGCAGGCAGCGCGGG + Intronic
1101131829 12:101697860-101697882 GGCCCCGGCGCCTGCCGCCATGG - Exonic
1102197191 12:111034067-111034089 GGGGCCGCCGCCGGCCGCCCGGG - Exonic
1103698638 12:122835909-122835931 GACCCCGGCCCCCTCAGCCCCGG - Intronic
1103853256 12:123946963-123946985 AGCGCCGCCGCACGCAGCCCCGG - Intronic
1103899339 12:124295343-124295365 CGCCCCGCCGCCGCCTGCCCCGG + Intronic
1103932443 12:124457846-124457868 GGCCCACCAGCCCGCAGCCTGGG + Intronic
1103944365 12:124517933-124517955 GGCCACTCAGCCCCCAGCCCTGG + Intronic
1104950666 12:132438511-132438533 AGCCCCACCGTCCGCAGGCCTGG - Intergenic
1104985010 12:132591778-132591800 GGCCCCATCTCCCGGAGCCCTGG + Intergenic
1105011769 12:132761408-132761430 GGCCCCTCCGCCCCCGGCCCGGG + Intronic
1105327175 13:19381267-19381289 GGCCCTGCAGGCCCCAGCCCAGG + Intergenic
1105512097 13:21060534-21060556 GGCCTGGCCGCCCGCAGCCCGGG + Intronic
1105864473 13:24447078-24447100 GGCCCTGCAGGCCCCAGCCCAGG - Exonic
1106286015 13:28318437-28318459 GGCCTTGCCACCCCCAGCCCTGG - Intronic
1107058446 13:36131028-36131050 GCCCGCTCCGCCCGCAGCCGCGG - Intronic
1108541472 13:51451603-51451625 GGCCCGGCCGCGCACAGCCCCGG - Intronic
1108668098 13:52652659-52652681 GTCCCCGCCCCTCGCAGCCATGG - Intergenic
1108688987 13:52846040-52846062 GGCTCCGCCGCCCGCCGCCCCGG + Exonic
1109284865 13:60397618-60397640 AGGCCCGCCGCCCGGGGCCCAGG - Intronic
1109284881 13:60397645-60397667 AGGCCCGCCGCCCGCCGCCCGGG - Intronic
1110705877 13:78602004-78602026 GCCGCCGCCGCCACCAGCCCGGG + Exonic
1111672383 13:91347839-91347861 GGGCCGGCCGGCCGCACCCCCGG + Intergenic
1111950480 13:94705484-94705506 GGGCCCGCGACCCGCAGGCCTGG + Intergenic
1112012180 13:95301530-95301552 CGCGCCGCCGCCTGGAGCCCGGG + Intergenic
1112344364 13:98577318-98577340 GGCCCCGCCGCCCGCCCGCGGGG - Intronic
1112494770 13:99896063-99896085 GGCCTCGTCGCCCGCGCCCCCGG + Exonic
1112567615 13:100564815-100564837 AGCCCCCCCGCCCCCTGCCCGGG - Intronic
1113076602 13:106473315-106473337 GGCCACTCCGCCCTCAGCTCTGG - Intergenic
1113200964 13:107867243-107867265 CGCCCCGCCGGAGGCAGCCCAGG - Intergenic
1113655915 13:112067735-112067757 GCCCCCGCCGCCGCCCGCCCCGG - Exonic
1114458428 14:22872135-22872157 CGCCTCCCCGCCCCCAGCCCTGG + Exonic
1117131954 14:52695677-52695699 GGCGCCCGCGCCGGCAGCCCGGG + Exonic
1117920226 14:60721456-60721478 GGCCCCGCAGCCCAAAGCCCGGG - Intronic
1119265744 14:73262533-73262555 GGCCCCGTCGTCCCCAGCCTGGG + Exonic
1119480633 14:74955658-74955680 GGCCCCGCCCACCGCAGACGAGG + Exonic
1119743511 14:77028496-77028518 GCTCCCGCCGCCCCCAGGCCTGG + Exonic
1119753512 14:77098073-77098095 GGCCCCGCCCCGCGCCGGCCTGG + Intergenic
1120765389 14:88323400-88323422 GCCCTCGCCGCGCGCTGCCCGGG - Intronic
1120881292 14:89417001-89417023 CCCCCCGCCGCCCGCCGCCCCGG - Intronic
1121050390 14:90816132-90816154 CGCGGCGCCCCCCGCAGCCCAGG + Intronic
1121050429 14:90816309-90816331 GGCCCGGCCGCCCGCCCCGCAGG + Exonic
1121145469 14:91578380-91578402 GGCAGCTCCGCCCGCGGCCCTGG + Intergenic
1121648165 14:95535168-95535190 GAGCCCGCCGCCCGCACGCCCGG - Exonic
1122221022 14:100239182-100239204 CGCCCGCCCGCCCGCAGCCGAGG + Exonic
1122221176 14:100239813-100239835 GCCGCCGCCGCCCGCCGCGCCGG - Exonic
1122329827 14:100904672-100904694 CGCCCAGCAGCCCCCAGCCCCGG - Intergenic
1122406667 14:101504906-101504928 GCCCCAGCCGCCTGCAGCCTTGG - Intergenic
1122504960 14:102226565-102226587 GGCCCCTCTGCCCTCAGCCCTGG + Intronic
1122582187 14:102777745-102777767 GGCCCCGCCGCCCAGGGCGCGGG - Intronic
1122633552 14:103119193-103119215 AGCCCCTCCCCCAGCAGCCCGGG - Intergenic
1122647515 14:103205193-103205215 GGCCCAGAAGGCCGCAGCCCAGG + Intergenic
1122779250 14:104136709-104136731 GGAGCCGCGTCCCGCAGCCCGGG + Intergenic
1123024846 14:105419770-105419792 GGCGCCGCCGCCCACCGCACGGG - Intronic
1123030598 14:105449454-105449476 GGCGCTGCCGCCCCCAGCCCAGG - Intronic
1123106396 14:105843752-105843774 GGCCCCTCCACCAGCAGCCAAGG + Intergenic
1123449869 15:20352748-20352770 GGCTCCTGCGCCCGCAGCCATGG - Intergenic
1123464595 15:20506069-20506091 GCCCCCGCCACCGGCCGCCCAGG + Intergenic
1123505764 15:20940780-20940802 GCCCCCGCCGCGGGCAGCCCTGG - Intergenic
1123562998 15:21514486-21514508 GCCCCCGCCGCGGGCAGCCCTGG - Intergenic
1123599245 15:21951769-21951791 GCCCCCGCCGCGGGCAGCCCTGG - Intergenic
1123653519 15:22494972-22494994 GCCCCCGCCACCGGCCGCCCAGG - Intergenic
1123743940 15:23303835-23303857 GCCCCCGCCACCGGCCGCCCAGG - Intergenic
1124109354 15:26772605-26772627 GCCCCCGCCTCCCTCCGCCCAGG + Intronic
1124275324 15:28322036-28322058 GCCCCCGCCACCGGCCGCCCAGG + Intronic
1124307380 15:28589565-28589587 GCCCCCGCCACCGGCCGCCCAGG - Intergenic
1124349299 15:28943726-28943748 GGCCCCGGCTCCTCCAGCCCTGG + Intronic
1124414595 15:29464725-29464747 GGCCTCGCTGCCCCCTGCCCAGG - Intronic
1124612068 15:31215752-31215774 GCCCCCGCCGCCCCGAGCCGTGG + Intergenic
1124972028 15:34496801-34496823 GGCCCAGGCATCCGCAGCCCAGG - Intergenic
1125464142 15:39934194-39934216 GGCCCCACGGCCCCCAGCCATGG - Exonic
1125505495 15:40265553-40265575 GGCCCAGCCGACCACACCCCTGG + Intronic
1126436714 15:48645117-48645139 GCCCCCGGCGGCAGCAGCCCCGG + Intronic
1129171327 15:73809973-73809995 AGCCCAGCCACCCACAGCCCTGG + Intergenic
1129695572 15:77739046-77739068 GGCCCAGCAGCCCCCACCCCAGG + Intronic
1131160531 15:90102171-90102193 GTCCCGCCAGCCCGCAGCCCGGG - Intronic
1131517610 15:93089316-93089338 GCGCCCCCCGCCCGCGGCCCGGG - Intergenic
1131827379 15:96332051-96332073 CCCGCCGCCGCCCGCAGCCAGGG + Exonic
1131832214 15:96361215-96361237 GGCCTCCCCGCCCCCGGCCCCGG + Intergenic
1131832317 15:96361545-96361567 GGTCCCGGCGGCGGCAGCCCGGG + Intergenic
1131846040 15:96491786-96491808 GGCAGCGCCACCTGCAGCCCCGG - Intergenic
1202971350 15_KI270727v1_random:241621-241643 GCCCCCGCCGCGGGCAGCCCTGG - Intergenic
1132475949 16:138280-138302 GCCCCCTCCGCCCCCGGCCCCGG - Exonic
1132484129 16:181393-181415 GTCCTCGCAGCCCGCCGCCCGGG - Intergenic
1132519710 16:381641-381663 TCCCGCCCCGCCCGCAGCCCCGG + Intronic
1132527750 16:426015-426037 GGCCCCGCCGGCCTCGCCCCCGG + Exonic
1132569038 16:636019-636041 GAGCCCACGGCCCGCAGCCCCGG - Intronic
1132576869 16:668336-668358 CGCCTCGCCCCGCGCAGCCCAGG + Exonic
1132579064 16:676899-676921 GGGCCCCCCGGCCGCTGCCCCGG + Intronic
1132656569 16:1044047-1044069 GCCCCCGCCGCCGCCGGCCCAGG - Intergenic
1132657665 16:1048135-1048157 GGCCCCTCCCCCAGCTGCCCTGG - Intergenic
1132710767 16:1266071-1266093 CCCCCAGCCCCCCGCAGCCCAGG - Intergenic
1132768374 16:1546702-1546724 GGCCCTCCCGCCCGCAGCTCTGG + Intronic
1132873078 16:2124205-2124227 GGCCCTGCTGCCCACAGCCCTGG - Intronic
1132935008 16:2475604-2475626 GGCCCCGCCCCGCCCCGCCCAGG + Intronic
1133095591 16:3443120-3443142 GCCCCCGACGCCCGAGGCCCAGG - Exonic
1133130199 16:3671973-3671995 GTCCCGGCCACCCACAGCCCAGG - Intronic
1133171169 16:3983287-3983309 GCCTCCCCCGCCCGCCGCCCTGG - Exonic
1133350654 16:5098338-5098360 GGCCCCGCCTCCCGGACCCTGGG - Intergenic
1133784421 16:8963588-8963610 GGGCCCGCCTCCCGCCGCCGGGG + Intronic
1133926131 16:10194073-10194095 AGGCCCGCAGCCCTCAGCCCCGG + Intergenic
1134112620 16:11524662-11524684 GGCCCCTCGGCCCCCAGCTCAGG + Intergenic
1134134083 16:11668419-11668441 GGCCCCGCCCGCCGCAGCGCGGG + Exonic
1134552167 16:15143386-15143408 GGCCCTGCTGCCCACAGCCCTGG - Intergenic
1135521626 16:23182654-23182676 GGCCCCGCCCCCACCTGCCCAGG - Intergenic
1135721820 16:24823868-24823890 GGGCTCGCCGCCTGCAGCCAGGG + Exonic
1135858166 16:26031253-26031275 GGCCCCGCCACTCCCCGCCCCGG + Intronic
1136396484 16:29995304-29995326 GCCTCCGCCTCCCGCGGCCCAGG + Exonic
1136460519 16:30407609-30407631 TGCCCAGCCGCCCGGCGCCCAGG + Exonic
1136683656 16:31981959-31981981 GCCCCCGCCGCCGCCAGCCCGGG - Intergenic
1136784283 16:32925519-32925541 GCCCCCGCCGCCGCCGGCCCGGG - Intergenic
1136885501 16:33928287-33928309 GCCCCCGCCGCCGCCGGCCCGGG + Intergenic
1137300501 16:47143905-47143927 GGCAGCTCCGCCCGCGGCCCCGG + Exonic
1138179234 16:54931050-54931072 GGCGCCGCGGGCCGGAGCCCCGG + Exonic
1138201408 16:55091408-55091430 GGACCCGCCTCCCTCAGCCCTGG - Intergenic
1138598413 16:58041540-58041562 GGCCCCGGGGCCCCCAGCACAGG - Intronic
1138693533 16:58790723-58790745 GGCCACTCCACCTGCAGCCCCGG - Intergenic
1139420161 16:66844870-66844892 GCGCCCGCCCCCCGCTGCCCTGG - Intronic
1139528362 16:67529750-67529772 GGCCCCGCAGACTGCAGCCAGGG - Exonic
1140927589 16:79599216-79599238 GCCGCCGCCGCCCCCAGCGCTGG + Exonic
1140927616 16:79599282-79599304 GGCCGCGCTGCCCGCGGCGCCGG + Exonic
1141445209 16:84053495-84053517 AGCCCGGCCGCCAGCAGCCTAGG + Intergenic
1141665425 16:85463048-85463070 GGCCCCGGGTCCCGCGGCCCGGG + Intergenic
1141797794 16:86286620-86286642 GGCCCCTCCTCCCGCTGGCCTGG - Intergenic
1142030749 16:87837262-87837284 GGGCCTGCAGCCCACAGCCCTGG + Intronic
1142177300 16:88651092-88651114 GGCCCCGCCCCCAGCCCCCCAGG + Exonic
1142361696 16:89630619-89630641 AGCCCCGGCACCCCCAGCCCTGG - Intronic
1142361704 16:89630634-89630656 AGCCCCGGCACCCCCAGCCCCGG - Intronic
1142361728 16:89630679-89630701 AGCCCCGGCACCCCCAGCCCCGG - Intronic
1142361736 16:89630694-89630716 AGCCCCGGCTCCCCCAGCCCCGG - Intronic
1142361744 16:89630709-89630731 AGCCCCGGCACCCCCAGCCCCGG - Intronic
1142361752 16:89630724-89630746 AGCCCCGGCACCCCCAGCCCCGG - Intronic
1142374657 16:89700873-89700895 GGCCCCGCGACCCGCAGGCCAGG + Intronic
1142377032 16:89711697-89711719 TGCCCCGCCCCACGCAGCCCTGG + Intronic
1203086940 16_KI270728v1_random:1189525-1189547 GCCCCCGCCGCCGCCGGCCCGGG - Intergenic
1142666793 17:1467953-1467975 GGGCCCTCCCCCTGCAGCCCTGG + Intronic
1143119863 17:4599903-4599925 GGCCCCGCCTCCCGGTGGCCTGG + Intronic
1143173254 17:4942385-4942407 TGCCCCACCACCCCCAGCCCCGG + Exonic
1143183526 17:4998013-4998035 GAGTCCGCCGCCCGCCGCCCGGG + Exonic
1143321226 17:6070451-6070473 AGCCCGGACGCCAGCAGCCCCGG + Intronic
1143620783 17:8079370-8079392 GGCAGCGCCGCCTGCAGCCCAGG + Intronic
1143780358 17:9225892-9225914 GGCCCGGCTGCCAGCAGCCCCGG + Intronic
1144128051 17:12220921-12220943 AGCGCCGCGGCACGCAGCCCCGG - Intergenic
1144519676 17:15945391-15945413 GGCCACGTCGGCCGCAGCCAGGG - Exonic
1144547966 17:16215332-16215354 GGCCCTGGCGCCTGCAACCCCGG - Intronic
1144782141 17:17813676-17813698 GGCCCCGGCCCCAGCAGCCCAGG - Exonic
1144789417 17:17849156-17849178 GGTCCCGCCCTCTGCAGCCCAGG - Intronic
1144953165 17:19004673-19004695 GGCCGCGCCCCCCGGATCCCGGG - Intronic
1145976258 17:28986053-28986075 GCGCCTGCCGCCCCCAGCCCTGG + Intronic
1146058690 17:29593533-29593555 GGCCCCCCGCCCCGCGGCCCCGG + Exonic
1146398803 17:32487929-32487951 GGCCCAGCCGCCTGCACCCCCGG + Exonic
1146896468 17:36545262-36545284 TTCCCCGCCGCCCGCCGCCCGGG - Intronic
1147144574 17:38477666-38477688 GCCCCCGCCGCCGCCGGCCCGGG - Exonic
1147179161 17:38674009-38674031 GGCCCCGCCTCGCCCGGCCCCGG - Exonic
1147210375 17:38869768-38869790 TAGCCCGCCTCCCGCAGCCCGGG + Intergenic
1147897450 17:43759877-43759899 TGCCCCCCCGCCCCCCGCCCCGG - Intergenic
1148603042 17:48908544-48908566 CGCCCCGGGGCCCGCCGCCCCGG - Exonic
1148759783 17:49993719-49993741 CGCTCCGCTGCCCGCGGCCCAGG + Intronic
1150218965 17:63485096-63485118 GGCCCCGCCTCTCCCACCCCTGG - Intronic
1150239859 17:63622673-63622695 GTCCCCGCCGCCCGGGCCCCCGG + Exonic
1150585718 17:66516150-66516172 AGCCCCGCCTCCCTCAGCCTTGG - Intronic
1150675725 17:67244994-67245016 GGCCCAGCCGCGGGCCGCCCAGG + Intronic
1151662319 17:75525527-75525549 GGCCCCGCCCCGCGCTTCCCGGG + Intronic
1151891766 17:76955372-76955394 GGCCACGCCTCCTTCAGCCCTGG + Intergenic
1152205693 17:78973397-78973419 GGCCCCGCCCCTTCCAGCCCTGG + Intronic
1152366653 17:79860354-79860376 GGCCACCCCGCCCGCTGCTCTGG - Intergenic
1152419025 17:80182217-80182239 GGACCTGTCACCCGCAGCCCCGG + Intronic
1152432094 17:80254137-80254159 AGCCCCGCAGCCAGCAGCCCTGG - Intergenic
1152571357 17:81122638-81122660 GGCCCCGCCGCACCGGGCCCGGG + Exonic
1152616265 17:81339370-81339392 GGCCCTGCCGCCCACAGGGCAGG + Intergenic
1152654991 17:81515115-81515137 TGCCCGCCCGCCCGCATCCCAGG - Intronic
1152697590 17:81804587-81804609 GGCCCCGGGCCCCGCCGCCCTGG + Intronic
1152705393 17:81841040-81841062 GGCACAGCTGCCCGCAGCACTGG - Intergenic
1152714505 17:81891948-81891970 GCCCCCAGCGCCCCCAGCCCTGG - Intronic
1152729281 17:81961707-81961729 CGCCCCACCTCGCGCAGCCCTGG + Intronic
1152834586 17:82520552-82520574 CGCGCAGCCGCCCGCAGCCCCGG - Intronic
1152866493 17:82726746-82726768 GTCCCCACCGCCCCCAGCCCAGG - Intronic
1152867956 17:82735522-82735544 GGCCGCCCCTCCCGCCGCCCGGG + Intergenic
1153285693 18:3452287-3452309 GGCCCCGCCGGCCGCATCGGTGG + Exonic
1153308973 18:3659446-3659468 CCCCCCGCCGCCCCCACCCCCGG + Intronic
1154172062 18:12059571-12059593 GGCCGCACTGCCCGCAGCCTGGG - Intergenic
1154231357 18:12559035-12559057 GGCACCTCTGCCCGCCGCCCTGG - Intronic
1154241506 18:12657768-12657790 GGCCGCGCCGCCGGCTGCCCCGG + Exonic
1154358778 18:13642222-13642244 GGCCCCGGCGCCAGCAGCGAGGG - Intronic
1155508268 18:26551059-26551081 GACCCCGCCGCCCGCAGAGGTGG - Intronic
1158435910 18:57435555-57435577 GGCGAGCCCGCCCGCAGCCCGGG + Intergenic
1159045615 18:63366804-63366826 GGACCCGCCCTCCGCAGCCTCGG - Intronic
1159102358 18:63970644-63970666 GGCCCCGCCACCCGCACTCCCGG - Intronic
1159770395 18:72541766-72541788 GCCCACCCCGCCCCCAGCCCGGG - Intronic
1160053216 18:75455838-75455860 GCCCCCGCTGCGCGCAACCCGGG - Intergenic
1160155620 18:76431954-76431976 GGCCCCGCCCACCACTGCCCTGG + Intronic
1160204604 18:76822615-76822637 GGGGCCGCCCCCCGAAGCCCAGG + Intronic
1160540231 18:79617151-79617173 GGGGCCGCGGCCGGCAGCCCCGG + Intergenic
1160736081 19:663012-663034 GACCCTGCCGCCCGCCGCCCCGG + Intronic
1160745395 19:709001-709023 GCCCCCGCGCCGCGCAGCCCCGG + Intergenic
1160761712 19:788825-788847 GGCCCCGCTGCACGCTCCCCCGG - Intergenic
1160769470 19:823825-823847 GGCCCCGCCTCTCACAGGCCAGG - Intergenic
1160775435 19:853109-853131 CCCCCCCCCGCCAGCAGCCCCGG - Intronic
1160835694 19:1123505-1123527 GGCCCGGCTGCACCCAGCCCTGG - Intronic
1160858974 19:1229701-1229723 GGCCCCGCAGCCCGCGCGCCTGG - Exonic
1160868915 19:1268206-1268228 GCCGCCGCCTCCCCCAGCCCTGG - Intronic
1160955004 19:1687063-1687085 GCCCCCGAAGCCCCCAGCCCAGG - Intergenic
1160967710 19:1753856-1753878 GCCCGCGCCGCCCGCGCCCCCGG - Exonic
1161057871 19:2199733-2199755 GGCCCCACCGGCTGCAGCCCTGG - Intronic
1161114550 19:2489270-2489292 GGCCCGGCCGCCCGCCGCCAGGG - Intergenic
1161124130 19:2546426-2546448 GGCCCTCCCGCCCGCAGCCCTGG - Intronic
1161165577 19:2785511-2785533 GGGCCCGCCGCCCGCGCTCCCGG - Exonic
1161215859 19:3094801-3094823 GGGCCCGCAGCCGGCAGGCCCGG - Intronic
1161333769 19:3700258-3700280 AGCCCAGCGGGCCGCAGCCCCGG + Intronic
1161394569 19:4038281-4038303 CGCCCCACCGCCCGCCGCCCGGG - Exonic
1161689463 19:5722729-5722751 GACCCCCCCCCCCGCAACCCCGG + Intronic
1161736431 19:5994893-5994915 GGCCCAGACGCCCGCAGCCTGGG - Exonic
1161849292 19:6730585-6730607 GGCCCCGCCCCCAGCAGCCCTGG + Intronic
1161952875 19:7477424-7477446 TGCCCCACAGCCCGCTGCCCCGG - Exonic
1161959452 19:7515930-7515952 GCCCCGCCCGCACGCAGCCCTGG - Intronic
1161973327 19:7595973-7595995 GGACCCGGCGCCCGCAGCCCCGG + Exonic
1162032938 19:7925174-7925196 CGCCCCGGAGCCCCCAGCCCGGG - Exonic
1162374476 19:10296543-10296565 GGCCGCGCCCCCCGCCGCCTCGG - Exonic
1162410499 19:10502655-10502677 GCCCGCGATGCCCGCAGCCCGGG + Intronic
1162823886 19:13239178-13239200 AGCCCCGCCCTCCCCAGCCCCGG + Intronic
1163282283 19:16325199-16325221 TGCCCTGTCGCCCGCAGCGCTGG + Exonic
1163370381 19:16897863-16897885 GGCCCGCGCGCCCGCACCCCCGG - Intronic
1163513919 19:17751645-17751667 GGCCCCCCTGCCCGGAGCCTGGG + Intronic
1163612268 19:18307777-18307799 GTCCCCCCCCCCCGCATCCCTGG - Intronic
1163698959 19:18777654-18777676 GGCTCCCTCGCCCCCAGCCCCGG + Exonic
1163765365 19:19160712-19160734 CGCCCCGCCTCACGCAACCCAGG + Intronic
1163821961 19:19501043-19501065 GCCCTGGCCGCCCCCAGCCCAGG - Intronic
1164840740 19:31390395-31390417 GGCCCTGGCGCCGGCAGCTCTGG + Intergenic
1165064603 19:33221636-33221658 AGCCCAGCCACCTGCAGCCCTGG + Intronic
1165309044 19:35019548-35019570 GGCCCCTCCACCCGATGCCCTGG + Intronic
1165349752 19:35269211-35269233 GGCCCCGCGGCCTGCAGGCCGGG + Intronic
1165408229 19:35643366-35643388 GGCCCCGCCCCTCTCGGCCCGGG + Exonic
1165850861 19:38849706-38849728 GCCGCCGCCGCCCGCCGCCCCGG + Exonic
1166121631 19:40690497-40690519 GCCCCCGCCTCCCGCGGCCCTGG + Exonic
1166242084 19:41501425-41501447 AGCTCCGCCTCCCGAAGCCCGGG + Intergenic
1166358591 19:42242280-42242302 GGCCCCGACGCCCCCACCCATGG + Exonic
1166361901 19:42255902-42255924 GGCCCCGCCTCCGGAACCCCCGG - Intergenic
1166832159 19:45645361-45645383 GGCCCCCCCGGTCCCAGCCCGGG + Exonic
1166843416 19:45712424-45712446 GCCCCCTCCGCCCCCTGCCCGGG - Exonic
1166882976 19:45940282-45940304 GCCCCCGCCTCCCGGAGCCCTGG - Exonic
1167268289 19:48493991-48494013 GGCCTCCCCGCCAGCCGCCCCGG + Exonic
1167738523 19:51311230-51311252 AGCCCCTCCTCCCTCAGCCCAGG - Intergenic
1168145966 19:54420386-54420408 GGCCCCAGCCCCCGCAGCCTGGG + Intronic
1168250183 19:55137478-55137500 AGCCCCTCCTCCCTCAGCCCAGG + Intronic
1168250268 19:55137729-55137751 AGCCCCTCCTCCCTCAGCCCAGG + Intronic
1168272640 19:55258490-55258512 CGCCCCGCCGCCGGCGGCTCCGG + Exonic
1168336587 19:55600568-55600590 GCCCCCGCCGCCCGCTTACCCGG + Intronic
1168443676 19:56393473-56393495 GGCCGCGCCCCCGGCAGCCCAGG + Exonic
925442940 2:3904038-3904060 GCCCCTGCCCCCCGCAACCCAGG + Intergenic
927213204 2:20651133-20651155 CGCCCTGCCTCCCGCTGCCCTGG + Intergenic
927215839 2:20667400-20667422 AGCCGCGGCGCCCGCAGCCTGGG - Exonic
927216633 2:20671086-20671108 GGCCCCTGCGCCCGTGGCCCCGG - Exonic
927720110 2:25376990-25377012 GATGCCGCCGCCTGCAGCCCGGG - Intergenic
932570631 2:72936560-72936582 CGCCCCGCCCCCCGCAGGCCTGG - Intergenic
932619850 2:73258959-73258981 GGCCCTGCCGCCCCCTACCCGGG + Exonic
933684732 2:85133752-85133774 GTCCCCTCCGCCGGCCGCCCCGG - Exonic
934797296 2:97112863-97112885 GGCGCGGCCGGCCGCAGCTCCGG + Intergenic
934836109 2:97590576-97590598 GGCGCGGCCGGCCGCAGCTCCGG - Intergenic
934966751 2:98730794-98730816 CGCCCCGCCGCCCGCCCCCGAGG + Intronic
935237483 2:101151048-101151070 GGGCCCGCGGCCCCCAGTCCCGG - Intronic
936346849 2:111681869-111681891 GGAAGCGCCGCGCGCAGCCCCGG - Intergenic
936512137 2:113157291-113157313 GCCCCCGCCACCCCCAACCCCGG + Intergenic
937596916 2:123684182-123684204 GGCCGCTCCACCTGCAGCCCCGG + Intergenic
937876264 2:126827677-126827699 GGCCTGGCTTCCCGCAGCCCTGG + Intergenic
938296458 2:130182304-130182326 GGCGCCGCCGACCCCGGCCCAGG - Exonic
938365068 2:130727762-130727784 GGCCACGCCCACCACAGCCCCGG - Intergenic
938365076 2:130727784-130727806 GACCACGCCCGCCGCAGCCCGGG - Intergenic
938460293 2:131492333-131492355 GGCGCCGCCGACCCCGGCCCAGG + Exonic
938555040 2:132416590-132416612 CACCCCGCCTCCCGCAGCTCGGG + Exonic
940361969 2:152805157-152805179 GGCCCAGGAGCGCGCAGCCCTGG + Intergenic
940830338 2:158458010-158458032 GGCCCCGCCGCTCGCTCTCCGGG - Intronic
941112122 2:161427186-161427208 GGCCCCGCGGCCTCGAGCCCCGG - Intronic
941819174 2:169827704-169827726 GTCCTCGCCGCCGGCAGCCGCGG - Exonic
942451028 2:176107999-176108021 GCCCCCGCCGCCACCAGCCCCGG - Exonic
943670011 2:190649577-190649599 GGCCGCGCTCCCCGCCGCCCTGG - Intronic
944242635 2:197500453-197500475 GGCCCCGAGGCCTGCAGGCCCGG + Intronic
945492897 2:210476712-210476734 GGCCTCTCACCCCGCAGCCCCGG + Exonic
945744290 2:213701633-213701655 GGCAGCTCCACCCGCAGCCCTGG + Intronic
945879618 2:215312221-215312243 GGTCCCGCCGGCCGCCGCCAAGG - Intronic
946340053 2:219060814-219060836 GGCCCTGCAGCCCGCCGGCCCGG - Intergenic
946354605 2:219176977-219176999 GGCCCCGCCTTCCGCCGCCGGGG - Intronic
946379046 2:219332179-219332201 GACCCCGATACCCGCAGCCCTGG + Intronic
947399114 2:229714572-229714594 GGCCCCGCCCGCCGTTGCCCGGG - Intergenic
947418482 2:229921706-229921728 GGCCCCGCCGCCGCCGGCGCCGG + Intronic
947748774 2:232522424-232522446 TGCCCCTCCGCCCGCATGCCGGG - Intronic
947911275 2:233802548-233802570 GTCCCCCCAGCCCACAGCCCTGG + Intronic
948479187 2:238239742-238239764 TGCCCCGCTCCCCGCAGGCCCGG - Exonic
948518261 2:238519723-238519745 GGCCCAGCCACCGGCAACCCTGG + Intergenic
948546899 2:238739088-238739110 GGCCCTGCTGCCCACAGACCAGG - Intergenic
949011066 2:241678888-241678910 GTCCCCGCCACCCACAGCCCAGG + Intronic
949012225 2:241687191-241687213 GGGCCCGCTGCGCGCAGCCAGGG - Intergenic
949041202 2:241850694-241850716 GGCCACGGCGCCTTCAGCCCCGG + Exonic
949041939 2:241853511-241853533 GGCCCCACTGCCCACTGCCCAGG - Intronic
1168991945 20:2102854-2102876 CCCCCCGCCGCCCGCAGCCATGG + Exonic
1171346493 20:24469773-24469795 GGCCCCTCCGCCCGCCCCCGCGG - Intronic
1172100694 20:32482997-32483019 GGACCCGCGGCGCGCACCCCGGG + Intronic
1172140894 20:32722473-32722495 GGCCACGCCTCCCACAGCGCTGG - Intronic
1172245683 20:33443692-33443714 GCCCCCGCTGCCCTCTGCCCTGG - Exonic
1172421877 20:34825238-34825260 AGCGCCCCCGCCCGCAGGCCTGG + Intronic
1173813110 20:45968325-45968347 GGCCCCGCCATCCTCAGCACTGG + Exonic
1173865217 20:46308621-46308643 GGCCCGGACCCCCGCAGCCGGGG + Intergenic
1174386693 20:50191602-50191624 TGCGCCGCCGCCCGGCGCCCCGG - Exonic
1174804766 20:53594733-53594755 GGGCCCGCGGCCCGAACCCCTGG + Intronic
1174873879 20:54207787-54207809 GGCCCCGCCGCGCTGAGCCTTGG + Intergenic
1175074096 20:56359101-56359123 CGCCCCGCCGCCCCTGGCCCTGG + Exonic
1175199113 20:57266143-57266165 GGGCCCGGAGCCCGGAGCCCGGG - Exonic
1175223774 20:57433135-57433157 GGCCCCGCCACACCCAGCCCTGG - Intergenic
1175234665 20:57501728-57501750 GGCTCTGCTGCCCGCTGCCCCGG - Intronic
1175428973 20:58889706-58889728 AGCCCAGCAGCCCGAAGCCCGGG + Intronic
1175517229 20:59577422-59577444 GGCGGCGCCGCCCCCGGCCCTGG + Intergenic
1175821011 20:61908848-61908870 GGCCCAGCCACCTGCAGCCCTGG + Intronic
1176081045 20:63273094-63273116 GGCCCCGCCGCCCAGCGCCGAGG - Intronic
1176113730 20:63422208-63422230 GGCCCCTCACCCAGCAGCCCAGG + Intronic
1176159951 20:63642775-63642797 GGCCCCTCCCCCAGCATCCCTGG - Intronic
1176170713 20:63695253-63695275 GCCCCAACCGCACGCAGCCCTGG + Intronic
1176178706 20:63739973-63739995 GGACCCTCCGCGCGCAGCCACGG - Exonic
1176234727 20:64049057-64049079 GCCCCCGCACCCCGCGGCCCGGG + Intronic
1176283330 20:64327732-64327754 GGCCCCGCTGCCGGCCGCTCCGG - Intergenic
1176367618 21:6043413-6043435 GGCCAGGCCTCCAGCAGCCCAGG + Intergenic
1176516719 21:7789654-7789676 GGCCAGGCAGCCCTCAGCCCAGG - Intergenic
1176547439 21:8207962-8207984 GGCCCCGCCACCGGGGGCCCCGG - Intergenic
1176555344 21:8252171-8252193 GGCCCCGCCACCGGGGGCCCCGG - Intergenic
1176566390 21:8391009-8391031 GGCCCCGCCACCGGGGGCCCCGG - Intergenic
1176574266 21:8435196-8435218 GGCCCCGCCACCGGGGGCCCCGG - Intergenic
1176733274 21:10521167-10521189 GGGCCCGCGGCCCGAACCCCTGG - Intergenic
1178314823 21:31559106-31559128 GGCCCCTCCGCCTGCGGCCTCGG + Intronic
1178650747 21:34419666-34419688 GGCCAGGCAGCCCTCAGCCCAGG - Intronic
1178981661 21:37269674-37269696 GCCCCCGCCGCCGTCAGCACCGG + Intergenic
1179012097 21:37563966-37563988 AGCACCGCCCCCCGAAGCCCGGG - Intergenic
1179522250 21:41953339-41953361 CGCCCCCCGGCCCGCAGTCCCGG + Intronic
1179626894 21:42653933-42653955 CGCCCCGCCGCGCCCGGCCCCGG - Intronic
1179712316 21:43270406-43270428 GGCCCCACTGCCCCCAGGCCGGG + Intergenic
1179755901 21:43495129-43495151 GGCCAGGCCTCCAGCAGCCCAGG - Intergenic
1179815479 21:43903520-43903542 AGCCCTGCCAGCCGCAGCCCTGG - Intronic
1180074236 21:45454700-45454722 TGCCCCCCCGCCAGCTGCCCAGG - Intronic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1181026687 22:20131328-20131350 GGGCCCGGCGCCCGCTGGCCGGG + Intronic
1181030485 22:20147042-20147064 GGCCACGCCGCCCCCATCCACGG - Exonic
1181670875 22:24424929-24424951 GGCCCCGACTCCCCCAGCCTAGG - Intronic
1181745439 22:24952666-24952688 GGCCCCGCCCCCAGCAGGCTAGG + Intergenic
1182189246 22:28442355-28442377 GGCCTCTCGGCCCGCCGCCCCGG + Intronic
1182278671 22:29205946-29205968 GCCCGCGCCGCCAGCCGCCCCGG - Exonic
1182546749 22:31081155-31081177 GGCCCCGCCCCTCGCGGGCCAGG - Intronic
1183220144 22:36506947-36506969 GGTCCCTACGCCCGCAGCTCCGG + Intronic
1183321971 22:37170447-37170469 GTCCCCGCTGCCCCCAGCCGTGG + Intronic
1183466952 22:37984674-37984696 GGCTCCTCCACCCGGAGCCCAGG + Intronic
1183546086 22:38455443-38455465 GGCCCCGCTGCGCTCGGCCCCGG + Intergenic
1183546250 22:38455961-38455983 GGCCGCGCGCCCCCCAGCCCGGG + Intergenic
1183665571 22:39244125-39244147 GGCGCCGCCGCCCCCGGCCCCGG + Exonic
1183903524 22:41022799-41022821 GGCGCTCCCGACCGCAGCCCAGG - Intergenic
1183961217 22:41413005-41413027 GGCCCAGCCGCCTGCTTCCCAGG - Intergenic
1184086819 22:42270440-42270462 GGCTCCGCCGCCTCCAGCTCGGG + Intronic
1184523850 22:45010022-45010044 GGCACCGCCCCCCGCCGCCCCGG - Intergenic
1184676295 22:46045087-46045109 AGCCCCGGCGCCCGCCACCCCGG - Intergenic
1184781762 22:46653224-46653246 GGCCGTGCCGCCCGCTGCCCCGG + Intronic
1184787707 22:46679902-46679924 CGCCCCGCCGCCGGCAGCCGTGG - Intergenic
1184796950 22:46738229-46738251 CCGCCCGCCGCCCGCCGCCCGGG - Exonic
1184987605 22:48146144-48146166 GGCCCCGCCGCATGCAACGCTGG - Intergenic
1185075078 22:48678602-48678624 GGCCGCACCACCTGCAGCCCTGG - Intronic
1185086491 22:48743671-48743693 GGCCCCGCCGTGGGCAGCCGAGG + Intronic
1185291891 22:50031441-50031463 GGCCGCTCCGCCCGCACGCCTGG + Intronic
1185296864 22:50058746-50058768 GGACCCGCAGCGCGCAGCCCGGG - Intergenic
1185342865 22:50299448-50299470 GGCCCCGCAGCCAGCAGCCAGGG + Intronic
1185384506 22:50525697-50525719 GGCCCCCGCCTCCGCAGCCCTGG + Intronic
1185398554 22:50604576-50604598 GACCCGGCCCCGCGCAGCCCGGG + Exonic
1185420200 22:50730771-50730793 GGCCCCGCCGCCCGGGCCCCCGG - Intergenic
1203252312 22_KI270733v1_random:124247-124269 GGCCCCGCCACCGGGGGCCCCGG - Intergenic
1203260369 22_KI270733v1_random:169333-169355 GGCCCCGCCACCGGGGGCCCCGG - Intergenic
950929363 3:16773736-16773758 GCAAGCGCCGCCCGCAGCCCCGG - Intergenic
951323133 3:21271582-21271604 GGCAGCTCCGCCCGCAGCCCTGG - Intergenic
951551805 3:23882485-23882507 GGCAGCTCCGCCCGCAGCCCCGG - Intronic
952430471 3:33218727-33218749 AGCGCCGCCGCCCAGAGCCCGGG + Exonic
952942259 3:38453986-38454008 GGCCCCTGCGCCCGGGGCCCGGG + Exonic
952970866 3:38649498-38649520 GCCCCCGCGCCCGGCAGCCCTGG - Intronic
953326103 3:42013708-42013730 AGCGCCCCCGCCCGCCGCCCCGG + Intergenic
953614484 3:44477756-44477778 AGCCCCGCCGCCCGCCGCACCGG - Intergenic
953638687 3:44685497-44685519 GCCAGCGCAGCCCGCAGCCCCGG + Intergenic
953657081 3:44862274-44862296 CGCAGCGCCGCCCGCGGCCCGGG - Intronic
953748636 3:45593820-45593842 GGCCCCGCCCCTGGCAGCGCTGG - Intronic
953918038 3:46933075-46933097 GGCACAGCCACCTGCAGCCCTGG - Intronic
953931779 3:47009343-47009365 GGCCCCGCCCCCGGCAGGCCTGG + Exonic
954618604 3:51983293-51983315 GGCCGCGGCGGCCGCTGCCCGGG + Exonic
954717423 3:52533604-52533626 GGTCCCGGCGCCCACTGCCCCGG - Exonic
954733534 3:52685754-52685776 CGCTCCGCCGCCTGCAGCCCCGG + Exonic
954806540 3:53224119-53224141 GGCCCCGGCGCCTGCTGCCCAGG + Intergenic
956605063 3:71065262-71065284 CGCCGCCCCGCCGGCAGCCCCGG - Intronic
957665221 3:83217952-83217974 GGAAGCGCCGCGCGCAGCCCCGG + Intergenic
957830056 3:85505017-85505039 GGAAGCGCCGCGCGCAGCCCCGG + Intronic
958692144 3:97481674-97481696 GGCCCCGCCCCGCACCGCCCCGG + Intronic
959920109 3:111859939-111859961 GGCACTGCCGACCCCAGCCCGGG - Intronic
961299916 3:125915989-125916011 GGCCCCGCCTCCCGGACCCTGGG + Intergenic
961320097 3:126067092-126067114 CGCCCCCCCGCCCCCCGCCCCGG + Intronic
961519271 3:127457231-127457253 AGCCCTGCCGGCCGCTGCCCTGG + Intergenic
961545238 3:127628950-127628972 GGCCCGGCCGCCCGCAGACCTGG - Intergenic
961646759 3:128396976-128396998 GGCCCCGCAGCCCACAGTCCTGG + Intronic
962277904 3:134029799-134029821 CGGCCAGCCGCCCGCAGCCATGG - Exonic
963236658 3:142963313-142963335 TGCCGCGGCGCCTGCAGCCCCGG - Exonic
963397964 3:144757301-144757323 GGCAACTCCGCCTGCAGCCCTGG + Intergenic
963827542 3:149971069-149971091 CGCCCGGCCGCCCGCAGCCGCGG + Exonic
964791836 3:160460314-160460336 GGACCCGCCCCCTTCAGCCCAGG + Intronic
964862866 3:161221430-161221452 GGGCCCGCGGCCGACAGCCCAGG - Intronic
966378709 3:179322919-179322941 GGACCACCGGCCCGCAGCCCCGG - Intergenic
966751967 3:183330968-183330990 TGCCCCGCCACCCCCACCCCAGG + Intronic
966849489 3:184155811-184155833 CGCCCCGCCTCCGGGAGCCCCGG + Intronic
966852074 3:184170611-184170633 GCCCCCGCCGCCCGCGGCCATGG + Exonic
967035356 3:185645293-185645315 AGCCCCGCCTCCCGCCCCCCAGG - Exonic
967858301 3:194134408-194134430 GGCCCGGCCGCCCGGGACCCGGG + Intergenic
968405534 4:336849-336871 GGCCCCGCCGCCCCCACCCCAGG - Intergenic
968514826 4:1011676-1011698 GGCCCCTCGCCCCGCCGCCCCGG + Intronic
968612608 4:1563997-1564019 GGTCCCGGCGGCCCCAGCCCTGG + Intergenic
968661393 4:1800196-1800218 TGCCCCGGCGCCCTCACCCCGGG - Intronic
968691402 4:1992172-1992194 GGCCCCACCCCCTGCTGCCCAGG - Intronic
968854558 4:3109870-3109892 GGCCCCCCCGTCCCCAGCACTGG - Intronic
969213877 4:5708302-5708324 GGCCCCGCCCCGCTCCGCCCCGG + Exonic
969617462 4:8262050-8262072 GGCACCCCTGCCCGCAGGCCTGG - Intergenic
969677673 4:8623326-8623348 GGCCACACGGCCCGCTGCCCAGG - Intergenic
969678628 4:8628967-8628989 GGCCACACGGCCCGCTGCCCAGG - Intergenic
969679584 4:8634605-8634627 GGCCACACGGCCCGCTGCCCAGG - Intergenic
969756269 4:9152661-9152683 GGCCCCGCCTCCCGGACCCTGGG + Intergenic
970333285 4:15004658-15004680 CGCCCGGCCGCCCGCGGCCCCGG - Intronic
970615688 4:17766762-17766784 GGCACCTCCGCCTGCTGCCCCGG - Intronic
971451348 4:26804619-26804641 GACCCCACCGGGCGCAGCCCAGG + Intergenic
972093520 4:35318696-35318718 GGCCAAGCAGCCAGCAGCCCAGG - Intergenic
973045456 4:45530860-45530882 GGCAGCTCCGCCCGCAGCCCTGG + Intergenic
973551236 4:52038124-52038146 GCCCGCGCCCCCCGCACCCCCGG + Intronic
973613699 4:52659367-52659389 CGCGCCGCCGGCCGCGGCCCAGG - Intergenic
973619518 4:52712697-52712719 GGCACCGCCGCCCGCCCCCCGGG - Intergenic
975160789 4:71121378-71121400 GGCAGCTCCGCCCGCGGCCCTGG + Intergenic
975420394 4:74157927-74157949 GGCCCCGCCCCCTGCGGACCCGG + Intronic
975986176 4:80202901-80202923 GCCCGCGCCGCCTGCGGCCCCGG - Exonic
976700573 4:87965813-87965835 GTCCCCGAAGCCCACAGCCCTGG + Intergenic
977941960 4:102868958-102868980 CGCCGCCCCGCCCGCCGCCCAGG + Exonic
978466326 4:109012879-109012901 GGCAGCTCCGCCAGCAGCCCTGG + Intronic
979674651 4:123398278-123398300 GGCCCGGCCGCGCGGAGCCGCGG + Intronic
981128399 4:141132617-141132639 GCCGCCGCCGCCCGCCGCCCCGG + Exonic
982157221 4:152535281-152535303 GGCCCCGCCGCCCTCGGGACTGG + Exonic
982358072 4:154490944-154490966 GGTCCCGCCGCTCGCGGTCCAGG + Intronic
983834169 4:172369434-172369456 GGCAGCTCCACCCGCAGCCCTGG - Intronic
983904451 4:173169253-173169275 GCCCGCTCCGCCCGCAGTCCCGG - Intronic
984702120 4:182825275-182825297 GGCCACCCTGCCCGCAGGCCAGG + Intergenic
984918176 4:184741611-184741633 GGCAGCTCCGCCTGCAGCCCTGG + Intergenic
985451636 4:190066410-190066432 GCCACCGTCGCCCGCCGCCCGGG + Intergenic
985802156 5:2011701-2011723 GGGCCCTCCTCCTGCAGCCCTGG + Intergenic
985895576 5:2748648-2748670 GCCCCGGTGGCCCGCAGCCCGGG + Exonic
985971552 5:3382249-3382271 GGCCTAGCCTCCTGCAGCCCAGG + Intergenic
986403003 5:7396829-7396851 GGCACCGCTGCCCGCAGCGCTGG + Intronic
986451541 5:7869675-7869697 GGCCCGGGCCCCAGCAGCCCCGG - Intronic
986608713 5:9546426-9546448 GGCTCCCCCGCCCGCTGTCCCGG + Intergenic
986719926 5:10553663-10553685 GGGGCCGCCGCCCCGAGCCCAGG + Intergenic
986721641 5:10564487-10564509 CGCCCCGCCGCCCTCCGGCCCGG - Exonic
986858928 5:11904150-11904172 GGCGCCGCCGCCAGCCGGCCGGG + Intergenic
986912566 5:12574815-12574837 GGAAGCGCCGCGCGCAGCCCTGG + Intergenic
986919097 5:12662311-12662333 GGCCGCTCTGCCCACAGCCCTGG + Intergenic
987050405 5:14143572-14143594 GCCGCCGCCCCCCGCCGCCCCGG + Intergenic
987896257 5:23951296-23951318 GGAAGCGCCGCGCGCAGCCCCGG - Intergenic
988020454 5:25614519-25614541 GGCAGCTCCGCCGGCAGCCCTGG - Intergenic
989812593 5:45695950-45695972 GGCCCCGCCGCCCCCCGGCGGGG + Exonic
990955173 5:61332853-61332875 GTCGCCGCCGTCCGCCGCCCCGG - Exonic
991711727 5:69415212-69415234 GGCCCGGCGGCCCCCGGCCCAGG + Intronic
993716556 5:91280651-91280673 GGCCTGGGCGGCCGCAGCCCGGG + Intergenic
994043354 5:95283765-95283787 GCCCCCGCCCCCCGCTCCCCGGG + Intronic
994167072 5:96618868-96618890 GGCAGCTCTGCCCGCAGCCCCGG + Intronic
994570370 5:101506436-101506458 GGCAGCTCCGCCCGCAGCCCTGG + Intergenic
995052727 5:107724753-107724775 CGCCCACCTGCCCGCAGCCCCGG + Intergenic
996551526 5:124735426-124735448 GGCCACGCCCCCAGGAGCCCAGG + Intronic
997598998 5:135126793-135126815 AGTCCCGCCGCCCACTGCCCAGG - Intronic
998040831 5:138950122-138950144 GTCCCTGCTGCCCCCAGCCCTGG - Intronic
998403702 5:141862049-141862071 GGCCCCGCTCCCTGCAGCTCAGG + Intronic
999322563 5:150624607-150624629 CGCCCCGCCCCGCCCAGCCCTGG - Intronic
1000052549 5:157575461-157575483 GCCCCCGCCGTCCCCAGCCTGGG - Intronic
1000568643 5:162882879-162882901 GGCAGCTCTGCCCGCAGCCCTGG + Intergenic
1001129152 5:169049079-169049101 GGCCCTGCCTGCCGTAGCCCTGG - Intronic
1001639091 5:173232744-173232766 GGCGGCGCGGCCTGCAGCCCTGG - Exonic
1002058091 5:176610120-176610142 GGCGCCGCCGTCCCCAGCGCCGG + Exonic
1002277468 5:178113462-178113484 GGCCCCGCCCCCCACATCCGGGG + Exonic
1002455857 5:179345109-179345131 TGCCCCGCCGCCCCCTCCCCAGG - Intronic
1002512747 5:179733355-179733377 GGCCCCGGCGCCCGCCGCCCCGG + Exonic
1002597756 5:180335268-180335290 GGGGCCGCAGCCCGAAGCCCAGG - Intronic
1002926851 6:1610014-1610036 GGCCCCCCCCCCCCCCGCCCTGG + Exonic
1002927284 6:1611692-1611714 GGCCGAGCCGCCCGCGCCCCCGG - Exonic
1003112122 6:3259212-3259234 CGCCCCGCCGCCCGCACCCTCGG - Intronic
1003171887 6:3726632-3726654 AGCCCTGCCGCCCACAGGCCCGG + Intronic
1003623944 6:7726517-7726539 GGCCCCGCTCCCCGCTGCCCCGG + Intergenic
1003908095 6:10720614-10720636 GGAAGCGCCGCGCGCAGCCCTGG - Intergenic
1004193975 6:13487713-13487735 GCCCCCGCCGCCGCCAGCTCCGG + Intergenic
1004492359 6:16129029-16129051 GGCCCCGCCCCCTTCAGCTCGGG - Intergenic
1005529621 6:26689776-26689798 GGACTCGCCACCCGCAGCCCTGG - Intergenic
1005541175 6:26811871-26811893 GGACTCGCCACCCGCAGCCCTGG + Intergenic
1005557525 6:27002591-27002613 GGACTCGCCACCCGCAGCCGTGG + Intergenic
1006300960 6:33193310-33193332 GGCGCCGCCGCCCGCTGGCGCGG + Intergenic
1006829341 6:36959319-36959341 AGCGCCGCCACCTGCAGCCCAGG + Exonic
1007363227 6:41373214-41373236 GACCCTGCCACCCGCAGCTCCGG - Intergenic
1007626134 6:43247320-43247342 GGCCGAGCAGCCCGAAGCCCCGG - Intronic
1009011984 6:57853943-57853965 GGACTCGCCACCCGCAGCCCTGG + Intergenic
1010199242 6:73268826-73268848 GGCACCTCCACCTGCAGCCCTGG - Intronic
1011633870 6:89352704-89352726 TGCCACCCCGCCCGCAGTCCAGG - Exonic
1012895354 6:104940844-104940866 GGCCCCGCCGCGCGCCTCACAGG + Intergenic
1014788438 6:125644472-125644494 GCAAGCGCCGCCCGCAGCCCTGG - Intergenic
1015786155 6:136922816-136922838 AGCACCGCCGCCAGCACCCCTGG - Exonic
1016992259 6:149938429-149938451 GACCCCGCCGCTCGCGGTCCAGG - Intergenic
1017007467 6:150038183-150038205 GACCCCGCCGCTCGCGGTCCAGG + Intergenic
1017291528 6:152743983-152744005 GGGCCAGGCGCCAGCAGCCCTGG + Intergenic
1018610946 6:165647300-165647322 GGCCCTGCCGCTGGCAGCTCCGG - Intronic
1018613039 6:165662126-165662148 GGCCAGGCCGCCCGCCGCGCGGG - Intronic
1019303685 7:322363-322385 GGCCACGCCCCCCGAGGCCCAGG + Intergenic
1019354532 7:571789-571811 GGCACCGCCCCACCCAGCCCCGG + Intronic
1019473594 7:1233545-1233567 TGCGCCGCCGCTTGCAGCCCGGG - Exonic
1019474157 7:1236125-1236147 GCCGCCGCCGCCCGCCGCCAAGG + Exonic
1019539377 7:1544977-1544999 GCCTCTGCCGCCCGGAGCCCAGG + Exonic
1019689825 7:2404156-2404178 GGCCCCGCCGACCGCAGCCCTGG + Intronic
1019711486 7:2520024-2520046 GCCGCCGCCGCCCCCAGCCCGGG - Exonic
1019719361 7:2559089-2559111 GCCCTGGCCGCCCGCAGCCTCGG - Exonic
1019719413 7:2559271-2559293 GTCTCCGTCGCCCGCAGCCTCGG + Intronic
1019900138 7:4013975-4013997 GTCCCCGCCGCCTGCGGCCGAGG + Intronic
1019989720 7:4682884-4682906 ACCCCCGCCGCCCGCACCCGGGG + Intronic
1020418280 7:7969680-7969702 GCCGCCGGCGGCCGCAGCCCCGG + Exonic
1021451555 7:20787009-20787031 GGCGCCGCCGCCTGCCGCCGTGG + Intergenic
1022698005 7:32728674-32728696 GGCCCCCCGGCCCCCAGCCCTGG - Intergenic
1022750400 7:33218994-33219016 GCAAGCGCCGCCCGCAGCCCGGG - Intronic
1023064777 7:36366845-36366867 GGTCCCGCCGCCCGGGGCTCAGG - Intronic
1023647807 7:42337402-42337424 GCCCCCCCGGCCCTCAGCCCTGG + Intergenic
1023937278 7:44748897-44748919 CTCCGCGCCGCCCGCCGCCCCGG - Intronic
1024226000 7:47327453-47327475 GGTCCTGCTGCCCGCTGCCCGGG + Intronic
1024578284 7:50782342-50782364 GGCCGATCCGCCCGCCGCCCCGG + Intronic
1026850373 7:73719744-73719766 GGCCCCGCCCCACCCCGCCCGGG + Intergenic
1026923732 7:74174528-74174550 GCCCCCGCCTCCCGCCGCCCCGG - Intronic
1026978466 7:74512981-74513003 GGCCCGGCCCTCCGGAGCCCTGG - Intronic
1027232661 7:76281735-76281757 GGCCGCGGCGCCCCCGGCCCCGG + Exonic
1029037965 7:97541531-97541553 GGCAGCTCCGCCCGTAGCCCTGG + Intergenic
1029360098 7:100082016-100082038 GCCCCCGCCGCCCGCCCCCAAGG - Intronic
1029746398 7:102517749-102517771 GCGCCCGCCGCCCGCCACCCCGG - Exonic
1029764337 7:102616728-102616750 GCGCCCGCCGCCCGCCACCCCGG - Exonic
1029896460 7:103989573-103989595 GCTCTCGGCGCCCGCAGCCCCGG - Intergenic
1030304352 7:108003388-108003410 GGCCCCGCCGCGCGCCGTTCTGG - Intergenic
1031919044 7:127588300-127588322 GGCCCCGCCTCCCCCGGCTCTGG - Intronic
1032151781 7:129435045-129435067 GGGCCCGCCGCAGGCAGCCTGGG - Intronic
1034426997 7:151019183-151019205 CGGCCCGCTGCCCGCTGCCCTGG - Exonic
1034441218 7:151086863-151086885 GCCGCCGCCGCCCCCGGCCCCGG - Exonic
1034441378 7:151087497-151087519 GGGCCCAGCGCCCGCAGGCCCGG + Intronic
1034522528 7:151632007-151632029 GGCCCGGCCGCCCGAGGACCGGG - Intronic
1034534621 7:151719255-151719277 GGCCCCGGCACGCTCAGCCCTGG + Intronic
1034885238 7:154793997-154794019 GGGACCGCCGACCCCAGCCCTGG - Intronic
1035015351 7:155761036-155761058 GGCTCAGTCACCCGCAGCCCTGG + Intronic
1035630190 8:1101518-1101540 GCCCCCTCCACCCCCAGCCCCGG - Intergenic
1035689208 8:1548820-1548842 AGCCCCGCCGACAGCTGCCCCGG + Exonic
1036033362 8:4994646-4994668 GGCCCCGGCCCCGCCAGCCCGGG - Exonic
1036795061 8:11749754-11749776 GCCCCCGGCACCTGCAGCCCCGG + Intronic
1036910779 8:12755438-12755460 GCCGCCGCCGCCCGCCGCCACGG + Exonic
1037826835 8:22164957-22164979 CGGCCCGCGGCCCGCGGCCCGGG + Exonic
1037883700 8:22585470-22585492 GGCCTGGCCGCCTGCAGTCCCGG - Intronic
1037903835 8:22703781-22703803 AGCGGCGCCGCCCGCGGCCCGGG - Intergenic
1037928928 8:22865788-22865810 GGCGCCGCCGCTCGCGCCCCCGG - Intronic
1038266986 8:26045410-26045432 AGCTCCGCCTCCCGCAGCCAGGG - Intergenic
1038540344 8:28385860-28385882 CGCCCCGCCCGCCGCGGCCCCGG + Intronic
1039949016 8:42153273-42153295 GTCCCCTCCGCCCGCAGCCGCGG - Intronic
1040003623 8:42600009-42600031 GGCAGCTCCGCCTGCAGCCCTGG - Intergenic
1040059699 8:43093648-43093670 GGCCGCACCCCCCGCAGCCCCGG + Intronic
1040928823 8:52713909-52713931 GGCCCCGGCGCCTCCCGCCCCGG - Intronic
1041068062 8:54101584-54101606 GCCCCCGCCCCCCGCGGACCCGG + Intronic
1041511599 8:58659669-58659691 GGCCCCGCCGCCGCCTGCCGAGG + Intronic
1042611754 8:70608027-70608049 TGCCCCGCCACCTCCAGCCCGGG - Intronic
1043463919 8:80486775-80486797 GCCGCCGCCGCCCGGTGCCCCGG - Exonic
1045215651 8:100145903-100145925 CGCCCGGCCGCCCGCAGGCCTGG + Intergenic
1045368105 8:101494154-101494176 GGCCCAGCGGCCCGCGGCCTTGG - Intronic
1046497841 8:115037099-115037121 GGCACCTCCGCCTGCTGCCCTGG + Intergenic
1049093762 8:140535637-140535659 AGCCGCGCCGCCCGCTGGCCAGG + Intronic
1049109797 8:140635649-140635671 GCCGCCTCCGCCCGCCGCCCCGG - Intergenic
1049273318 8:141707601-141707623 GGCCCCGCCATCCGCAGACGGGG + Intergenic
1049462896 8:142738393-142738415 GCCCCAGCCGCCCCCACCCCCGG + Intergenic
1049550989 8:143259608-143259630 GGCCCCCCCGCCCCCAACCCTGG + Intronic
1049621074 8:143598566-143598588 GGCCCCGCCGCCCCCGGCCGAGG + Exonic
1049676230 8:143890507-143890529 GGCCCTGCCTCCTGCAGCCCCGG + Intergenic
1049689886 8:143953779-143953801 GGCACAGCCGCCCTCAGCCCCGG - Intronic
1049796875 8:144501008-144501030 GGCCCCGCGGACGTCAGCCCCGG + Intronic
1053323472 9:37120643-37120665 ACCCCCGCCGCCCGCGGCTCGGG + Exonic
1053697321 9:40650461-40650483 TGCCCCCCCGCCCGCCGCCTCGG - Intergenic
1054308629 9:63449910-63449932 TGCCCCCCCGCCCGCCGCCTCGG - Intergenic
1054489517 9:65762924-65762946 TGCCCCCCCGCCCGCCGCCTCGG + Intergenic
1055397535 9:75891056-75891078 GCCGCCGCAGCTCGCAGCCCCGG - Exonic
1056186525 9:84140504-84140526 GCCCCAGCCGGCTGCAGCCCCGG + Intergenic
1056992370 9:91423791-91423813 GGCCACGGCGCCCGCGGACCCGG - Exonic
1057208135 9:93185211-93185233 CGCCCCCGCGCCCGCAGCGCTGG + Exonic
1057665225 9:97039319-97039341 GGCCCAGCTTCCCGCAGCCAGGG - Intronic
1059102194 9:111482817-111482839 GGCCGCCCCGCCCGCCGCCGGGG - Intronic
1059470933 9:114504715-114504737 GCCCCCGCCGCCGCCCGCCCCGG + Exonic
1060468619 9:123929811-123929833 CGGCCCGCGGCCTGCAGCCCTGG + Intronic
1060980022 9:127786367-127786389 GGCCGCGCCGCACCCCGCCCCGG + Intronic
1061293699 9:129666141-129666163 GGCCCCGCCACCCCCGTCCCTGG - Intronic
1061297459 9:129684651-129684673 GGCCCCACCCCACACAGCCCAGG - Intronic
1061583994 9:131554794-131554816 GGCGCCGCCGGCCGCCGCCTTGG - Intergenic
1061589226 9:131588092-131588114 TGCTCTGACGCCCGCAGCCCGGG - Intronic
1061664469 9:132152390-132152412 GGCCGCGCCGCTGGCTGCCCAGG + Intergenic
1061723112 9:132565886-132565908 GCCACAGCCGCCAGCAGCCCTGG - Intronic
1061725594 9:132580483-132580505 GGCCCCGCCGCCGGCCGGGCTGG - Intergenic
1061882897 9:133576924-133576946 GGCCCCGCCGGGCAGAGCCCTGG + Intergenic
1062064430 9:134518484-134518506 AGCACAGCCGCCCGCAGGCCAGG - Intergenic
1062282577 9:135758631-135758653 TGGCCCGACACCCGCAGCCCAGG - Intronic
1062318067 9:135978005-135978027 GACCCCCCCACCAGCAGCCCTGG + Intergenic
1062339206 9:136086437-136086459 AGCCCAGCCGCTCGCAGACCTGG - Intronic
1062427577 9:136512981-136513003 GGCCCCGCCCCCTCCAGCACAGG + Intronic
1062430242 9:136523656-136523678 AGGCCCGCCGCCAGCTGCCCAGG - Intronic
1062578303 9:137218617-137218639 AGCCCCGCCGCCAACAGGCCAGG + Intergenic
1062609835 9:137368900-137368922 GGCGCCCCTGCCCACAGCCCTGG - Intronic
1203772816 EBV:58114-58136 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772823 EBV:58129-58151 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772830 EBV:58144-58166 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772837 EBV:58159-58181 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772844 EBV:58174-58196 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203468717 Un_GL000220v1:107398-107420 GGCCCCGCCACCGGGGGCCCCGG - Intergenic
1203476538 Un_GL000220v1:151370-151392 GGCCCCGCCACCGGGGGCCCCGG - Intergenic
1185877693 X:3713539-3713561 CGCCTCGCCCCCCCCAGCCCGGG - Exonic
1186898852 X:14032101-14032123 GCCCCCTCCTCCCCCAGCCCAGG - Intergenic
1188542585 X:31266676-31266698 CGCCCAGCCGCCCGGCGCCCCGG + Intronic
1188811429 X:34657344-34657366 GGCACCGCCTCCCGCAGCCCGGG - Intergenic
1189001973 X:36957612-36957634 GGCACCACCTCCCGCAGCCTGGG + Intergenic
1189325693 X:40109512-40109534 GGCTCCGCCGCCCGGGGCCGGGG - Intronic
1190246922 X:48696879-48696901 GGCCCCGGCGTCCGAGGCCCCGG + Intronic
1192177322 X:68894270-68894292 TGCCCCGCCACCACCAGCCCAGG - Intergenic
1196771565 X:119300088-119300110 GGCCGCTCCACCTGCAGCCCTGG + Intergenic
1196819571 X:119692461-119692483 GGCGCCGCCGCCGCCCGCCCGGG + Intronic
1198099896 X:133414711-133414733 CGCCCCGCCGCCCCCTGCGCCGG - Intronic
1198388183 X:136147828-136147850 CGTCCCGCACCCCGCAGCCCGGG - Intronic
1198806391 X:140499507-140499529 GCCCCAGCTCCCCGCAGCCCAGG + Intergenic
1199591385 X:149471128-149471150 GGCGCCGCCGCCTTCCGCCCTGG - Intergenic
1199772637 X:150984150-150984172 GGCCCCGGCGCCCGCGGCCCGGG + Intronic
1200118843 X:153781061-153781083 GGCCACGCAGCCCGCAGCTCCGG - Exonic
1201062438 Y:10059305-10059327 GGCCTCTCAGCCCCCAGCCCTGG - Intergenic
1202604637 Y:26628333-26628355 GGCCCTGCAGGCCCCAGCCCAGG - Intergenic