ID: 922821409

View in Genome Browser
Species Human (GRCh38)
Location 1:228487925-228487947
Sequence GGACCGGGGCGGGGGCGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1622
Summary {0: 1, 1: 4, 2: 21, 3: 208, 4: 1388}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922821409_922821417 -9 Left 922821409 1:228487925-228487947 CCTCTCCGCCCCCGCCCCGGTCC 0: 1
1: 4
2: 21
3: 208
4: 1388
Right 922821417 1:228487939-228487961 CCCCGGTCCCCCTGAGCCCTGGG 0: 1
1: 0
2: 3
3: 23
4: 339
922821409_922821415 -10 Left 922821409 1:228487925-228487947 CCTCTCCGCCCCCGCCCCGGTCC 0: 1
1: 4
2: 21
3: 208
4: 1388
Right 922821415 1:228487938-228487960 GCCCCGGTCCCCCTGAGCCCTGG 0: 1
1: 0
2: 1
3: 35
4: 365
922821409_922821430 22 Left 922821409 1:228487925-228487947 CCTCTCCGCCCCCGCCCCGGTCC 0: 1
1: 4
2: 21
3: 208
4: 1388
Right 922821430 1:228487970-228487992 GTCTCCACTGTTCCTGTCCCCGG 0: 1
1: 0
2: 1
3: 37
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922821409 Original CRISPR GGACCGGGGCGGGGGCGGAG AGG (reversed) Intronic
900119138 1:1041102-1041124 GGAGCGGGGCGGGAGCGGGGCGG + Intronic
900155226 1:1201189-1201211 GGGCCGGGGTCGCGGCGGAGAGG - Intergenic
900180378 1:1308536-1308558 CGGCCGGGGCCGGGGGGGAGGGG + Intronic
900190076 1:1349511-1349533 GGGGCGGGGCCGGGGCGGGGCGG - Intergenic
900196334 1:1377694-1377716 GGACTGGGTCGAGGGCAGAGTGG + Intergenic
900242450 1:1623530-1623552 GGACGGCGGCGAGGGCGGCGTGG + Exonic
900314348 1:2049713-2049735 GGAGCTGGGCGGCGGTGGAGGGG + Intergenic
900337135 1:2169788-2169810 TGACGGGGGCGGGGGGGGCGGGG + Intronic
900344707 1:2205192-2205214 GGAGCGGGGGCGGGGCGTAGGGG - Intronic
900365754 1:2311319-2311341 GGGCAGGGGCGTGGGCCGAGGGG + Intergenic
900431232 1:2604118-2604140 GGGCCGGGGCGGGTGGGGAGCGG - Intronic
900512861 1:3068601-3068623 GGGCGGGGACGGGGGCCGAGGGG + Intergenic
900513136 1:3069599-3069621 GGCCGGGGAGGGGGGCGGAGGGG + Intronic
900524210 1:3120595-3120617 GGACAGGGGCAGGGACAGAGGGG - Intronic
900537121 1:3184388-3184410 GGTGCGGGGCGGGGGCCGGGAGG + Intronic
900647908 1:3717309-3717331 GTACTGGGGCGGGGGAGGAGGGG + Intronic
900998131 1:6133847-6133869 GGGCCAGGGCAGGGGAGGAGGGG + Intronic
900998479 1:6135440-6135462 GGACCGGGGCAGGGGAGGCAGGG + Intronic
901066501 1:6497087-6497109 GCACCGCGGTGGGGGCAGAGCGG + Exonic
901157090 1:7148421-7148443 GGAGCGTGGCGGGGGGGGAGGGG - Intronic
901433876 1:9234713-9234735 CGGCGGGGGCGGGGGCGGGGCGG - Intergenic
901526050 1:9823998-9824020 GTACCCGGCCGGGGGCGGGGTGG + Exonic
901659854 1:10792323-10792345 GGGCCGGGGGGGGGGGGGCGGGG - Intronic
901798027 1:11691751-11691773 GGAACGGGGCCGGCGTGGAGAGG - Exonic
901810070 1:11762389-11762411 GGACAGGGGTGGGGGTGGAGTGG + Intronic
902214124 1:14924043-14924065 GCGGCGGGGCGGGGGCGGGGCGG + Intronic
902348209 1:15834939-15834961 GGGGCGGGGTGTGGGCGGAGCGG - Intergenic
902542969 1:17167305-17167327 GGGGCGGGGGGGGGGCGGTGTGG - Intergenic
902585709 1:17437880-17437902 TTCCCGGGGCGGGGGGGGAGGGG + Intronic
902585731 1:17437954-17437976 GGCCCGCGGCGGGGGAGGGGCGG - Intronic
902770012 1:18640468-18640490 AGGAAGGGGCGGGGGCGGAGAGG + Intronic
902867363 1:19288363-19288385 GAACAGGGGTGGGGGCGGTGGGG + Intronic
902896883 1:19485406-19485428 GGGCCGGGGAGGGGGCCGTGCGG + Intronic
902920811 1:19665228-19665250 GTACCAGGGCGGGGGCCTAGGGG - Intergenic
902940971 1:19799941-19799963 GGACCGGGGCCGGGACGCGGCGG - Intronic
903190166 1:21651901-21651923 GGGCGGGGGCGGGGGCGGGGCGG - Intronic
903233796 1:21937112-21937134 GGCGGGGGGCGGGGGCGGAGGGG - Intronic
903263392 1:22143008-22143030 GGGCCGGGGCGCGCGCGGCGGGG + Intronic
903347954 1:22699806-22699828 TGACGGGGGTGGGGGCGGAGGGG - Intergenic
903468366 1:23568128-23568150 GGCGCGGGGCGCGGGCGGGGAGG - Intergenic
903501164 1:23800795-23800817 GGGCGGGGTCGGGGCCGGAGTGG - Exonic
903596995 1:24502751-24502773 GGACCGGGGCGGGGGCGCGCGGG - Intronic
903643514 1:24876367-24876389 GGGGCGGGGCGGGGCAGGAGTGG + Intergenic
903777071 1:25800161-25800183 GGGCGGGGCCGGGGGCGGGGCGG - Exonic
903851154 1:26306815-26306837 GGTCCGGGGCGGGGTGGGGGGGG + Intronic
903907358 1:26696328-26696350 GCCCCGGGGCGGGGTGGGAGGGG + Exonic
903938158 1:26910893-26910915 GGAGAGGGGCTGGGGCAGAGGGG + Intronic
903969116 1:27107621-27107643 GGGCCAGGGCTGGGGCGGGGTGG - Intronic
904050210 1:27634293-27634315 AGACCGCCGCGGGCGCGGAGGGG + Intronic
904053861 1:27657466-27657488 GGGAAGGGGAGGGGGCGGAGAGG - Intergenic
904097508 1:27992262-27992284 GGACCTGGGTGGGGGGCGAGAGG + Intronic
904330294 1:29754158-29754180 GGAGTGGGGCGTGGGGGGAGTGG + Intergenic
904373617 1:30066190-30066212 GGGCTGGGGCAGGGGTGGAGTGG - Intergenic
904467801 1:30718534-30718556 GTGCCGGGGCGGGGCCGGGGAGG - Intronic
904467819 1:30718593-30718615 GGGCAGGGGCGGGGCCGGGGGGG - Intronic
904483289 1:30807383-30807405 GGCCCGGGGCGGGGGCGGGGTGG - Intergenic
904751044 1:32741689-32741711 GGACCGGGGGAGGCGGGGAGGGG + Intergenic
904770075 1:32876222-32876244 GGACGGGGGCGGGGGGTGGGGGG + Intergenic
904822892 1:33256664-33256686 GGCCCGGGGCGCGCGGGGAGCGG + Intronic
905037879 1:34929492-34929514 GGCCCGGGCCGGGGGCGCTGCGG + Exonic
905054239 1:35079361-35079383 GGAGAGGGGCGGGGTCGGCGGGG + Intronic
905126458 1:35718964-35718986 GGCCCCGCGCGGGGGCGAAGCGG - Exonic
905414212 1:37793768-37793790 GGGCGGGGGCGGAGGCGGGGCGG - Intergenic
905515627 1:38559829-38559851 GGGGCGGGGCGGGGGGCGAGCGG + Intergenic
905580591 1:39081050-39081072 GCCGCGGGGCCGGGGCGGAGAGG + Intergenic
905648272 1:39639688-39639710 GGGCCGGGGCGGGGCCGGGGCGG - Exonic
906090291 1:43172669-43172691 GGCCGGGGGCGGGGTCGGAGCGG + Intronic
906488161 1:46247488-46247510 GGGCGGGGGCGGGGGTGGCGGGG - Intergenic
906641870 1:47445799-47445821 GGGCCGGGGTGGGGGTGGGGAGG - Intergenic
906805545 1:48776524-48776546 GGCCGGGGGCCCGGGCGGAGGGG - Intronic
907093479 1:51752234-51752256 AGCCGGGGGCGGGGGTGGAGGGG - Intronic
907429856 1:54405725-54405747 GGATCGGGGAAGGGGCGGTGGGG - Intronic
907499407 1:54867378-54867400 GGAACAGGGCTGGGGCAGAGTGG - Intronic
908082775 1:60598527-60598549 GGACAGGGGCGGGGGGAGAAGGG + Intergenic
908501223 1:64745239-64745261 GGGCCGGGGCCGGGGCTGCGCGG + Exonic
908534872 1:65067564-65067586 GGCCGGGCGCGGGGGCGGCGGGG - Intergenic
908703299 1:66924893-66924915 GGAGGAGGGCGGAGGCGGAGGGG + Intronic
908703945 1:66930447-66930469 GGCCCTGGGCCGGGGAGGAGTGG + Intronic
909393122 1:75137155-75137177 GGACCGGGGCGAGGACGACGGGG - Exonic
911767918 1:101701652-101701674 GGAGTGGGGAGGGGGGGGAGGGG - Intergenic
911820336 1:102411300-102411322 GGACAGGGGAGGGGGAGGGGAGG + Intergenic
912301953 1:108526923-108526945 GGGCTGGGGCGGGGGCGGGGGGG - Intergenic
912536877 1:110380628-110380650 GGGCGGGGGCGGGGGGGGAAGGG + Intronic
913047938 1:115089525-115089547 GGACCGGGGCGGGGCCTCCGGGG + Intergenic
913131194 1:115839281-115839303 GGCCCGGGGCGGGGCAGGCGGGG + Exonic
914240095 1:145847419-145847441 GGAGCTGGGCGGGGGTGGCGGGG + Intronic
914986717 1:152464325-152464347 GGACTGTGGTGGGGGGGGAGGGG - Intergenic
915026869 1:152839053-152839075 GGACTGTGGTGGGGGGGGAGGGG - Intergenic
915145776 1:153795122-153795144 GCAACGGGGAGGGGGCGGGGTGG - Intergenic
915326915 1:155085478-155085500 GCTCCGGGGCGGGGCCGGCGCGG + Intronic
915549474 1:156624167-156624189 GGAATGGGGCGGGAGCGGAAGGG - Intronic
915586910 1:156848893-156848915 TGCCGGGGGCGGGGCCGGAGCGG - Intronic
915722704 1:157995888-157995910 GGACTGGGGAGGAGGCAGAGAGG + Intronic
915835737 1:159173220-159173242 AGGGCGGGGCGGGGGTGGAGAGG + Intronic
915977459 1:160400545-160400567 GCAGGGGGGAGGGGGCGGAGGGG - Intergenic
916059655 1:161089694-161089716 GGACCTGGGTGGGGGCGGTGGGG + Intergenic
916651668 1:166839617-166839639 GGGCGGGGGCGGCGGCGGCGCGG + Intronic
916666627 1:166973608-166973630 GCATCGGGGGGGGGGGGGAGGGG - Intronic
917291617 1:173477266-173477288 GGACTGGGGCGGCGGGGGCGGGG - Exonic
917739401 1:177947783-177947805 GGACAGGGAGGGGAGCGGAGGGG + Intronic
917905853 1:179586652-179586674 AGGCGGGGGCGGGGGCGGCGGGG + Intergenic
918040540 1:180911921-180911943 GTACCGGGGCAGGGGAGGAGGGG - Intergenic
918040956 1:180913339-180913361 GGACCGGCGGGGCGGAGGAGCGG + Intronic
918046134 1:180942059-180942081 GGAGCGGGGCTGGGGGGGTGGGG - Intronic
918177260 1:182057278-182057300 GGGCCGGCGCGAGGGCGGAGAGG - Exonic
918423641 1:184387312-184387334 GGACAGGGGCGGGGGGCGGGAGG + Exonic
919895701 1:202008449-202008471 GGCCCAGTGCGGGGGCGGGGGGG + Exonic
919899244 1:202031830-202031852 TGACAGGGGCGGTGGCGGTGGGG - Intergenic
920071790 1:203307440-203307462 CGCCCAGGGCGGGGGCGGAAGGG - Exonic
920100507 1:203514264-203514286 AGACTGAGGCGGGGGAGGAGAGG - Intergenic
920120235 1:203650638-203650660 GGCCCGGGGCGAGGGCGGGCGGG + Intronic
920139226 1:203795832-203795854 GGGCCGGGGAGGTGGGGGAGAGG + Intronic
920184587 1:204152077-204152099 GGGCCGGGGCGGGGGCGGGCCGG - Intergenic
920385662 1:205568962-205568984 GGCCCGCGGCGGGGAGGGAGGGG - Exonic
920394088 1:205631550-205631572 GAGCGGGGGCGGGGGCCGAGGGG - Intronic
920556635 1:206909357-206909379 GGATCGCGGCGGCGGCGGCGCGG + Intronic
920572128 1:207025078-207025100 GGTTGGGGGCGGGGGCGGGGAGG + Intronic
920935403 1:210428985-210429007 GGAGCGAGGTGGGTGCGGAGGGG - Intronic
921029701 1:211326764-211326786 GGGCCGGGGCGCGGGCGGAGGGG - Intronic
921262901 1:213399654-213399676 GGTCTGGTGCGGGGGAGGAGAGG - Intergenic
921390296 1:214608245-214608267 GGACCAGGCCGGGGGCCGGGGGG - Intronic
921432848 1:215083197-215083219 GGACGCGGGAGGGGGCGGGGGGG - Intronic
921890955 1:220353251-220353273 GGACGGGGGCGGGGCAGGACAGG - Intergenic
921923241 1:220690825-220690847 GAATGGGAGCGGGGGCGGAGGGG - Intronic
922116313 1:222617935-222617957 GGGCGGGGGCGGGGACGGGGCGG - Intergenic
922116341 1:222617982-222618004 GGGCTGGGGCGGGGACGGGGCGG - Intergenic
922116358 1:222618014-222618036 GGGACGGGGCGGGGACGGGGGGG - Intergenic
922116366 1:222618025-222618047 GGACGGGGGCGGGGACGGGGCGG - Intergenic
922116380 1:222618050-222618072 AGGCCGGGGCGGGCGCAGAGGGG - Intergenic
922440611 1:225652897-225652919 AGGCTGGGGAGGGGGCGGAGAGG + Exonic
922505356 1:226122582-226122604 CGGCCGGCGCGGGGGCAGAGGGG + Intergenic
922526674 1:226309346-226309368 GGCCGGAGGCGGCGGCGGAGGGG - Exonic
922804439 1:228378201-228378223 AGACCAGGGCGGAGGGGGAGGGG - Intronic
922809327 1:228407075-228407097 GGACAGGGGGCGGGGCGCAGGGG + Intergenic
922809342 1:228407106-228407128 GGACAGGGGGCGGGGCGCAGGGG + Intergenic
922821409 1:228487925-228487947 GGACCGGGGCGGGGGCGGAGAGG - Intronic
922933341 1:229407032-229407054 AGACCAGGGCGGGAGGGGAGGGG - Intergenic
922958549 1:229625799-229625821 GGGCGGGGGCCGGGGCGGTGGGG - Intronic
923055838 1:230425692-230425714 GGCGCGGGGCGGTGGCGGGGCGG + Intronic
923171697 1:231422370-231422392 GGGCCGGGGGGAGGGCCGAGGGG + Exonic
923291167 1:232547561-232547583 GGCCCGGGGTGGGGGCTGGGTGG + Intronic
923400783 1:233614081-233614103 GGGCGGGGGCGGGGGCGGCGGGG + Exonic
923534433 1:234838185-234838207 GGAGGGGGGCGGGGTAGGAGAGG + Intergenic
923592168 1:235328493-235328515 GGACCGGTGCGGGGGCGGGGGGG + Intronic
923684141 1:236142399-236142421 GGGCCGGGGCGGGGGCGCGCGGG + Intergenic
923684151 1:236142419-236142441 GGGCCGGGGCGGGGGCGCGCGGG + Intergenic
923744305 1:236686411-236686433 GGCCGGGGGCGGTGGCGGCGGGG + Intergenic
923879141 1:238084336-238084358 GGCCAGGGGTGGGGGAGGAGTGG + Intergenic
924026601 1:239839791-239839813 GTGGCGGGGCGGGGGGGGAGCGG + Intronic
924037920 1:239955077-239955099 GGACGCGGGCGGGGGCGGGGGGG - Intergenic
924052283 1:240091755-240091777 GGAGCCGCGCGGGGGCAGAGGGG + Intronic
924289663 1:242524526-242524548 GGGCGGGGGCGGGGGCGGAGGGG + Intronic
924436568 1:244048626-244048648 GGGCGGGGGCGGGGGGGGGGCGG - Intergenic
924560447 1:245154021-245154043 GGACTGGGGCGGGGGGCGATCGG + Intergenic
924706588 1:246507325-246507347 GGGGCGGGGCGGGCGCGGTGGGG + Intergenic
924803867 1:247347579-247347601 GGAGCGGGGGGGGGGGGGGGCGG - Intergenic
1062847256 10:717682-717704 GGCCTGGGGCGGGGACGGTGAGG - Intergenic
1063115129 10:3067490-3067512 GGGCGGGGGCGCGGGCGGGGCGG + Intronic
1063116627 10:3076375-3076397 GGGCTGGGGCGGGGGCGCGGCGG - Intronic
1063121307 10:3106896-3106918 GGAGAGGGGCAGGGGCGAAGGGG - Intronic
1063154952 10:3370611-3370633 GGGGCGGGGTGGGGGCGGGGGGG - Intergenic
1063178173 10:3570863-3570885 GGACAGGGGCAGGGGCTGAGGGG + Intergenic
1063200971 10:3785260-3785282 GGAGCCAGGCGGGGGCGGAGGGG - Exonic
1063450155 10:6145454-6145476 GGCCCGGGGCTGGAGCGCAGCGG - Intronic
1064179184 10:13100175-13100197 GGGCGGCGGCGGTGGCGGAGGGG - Exonic
1064213895 10:13383586-13383608 TGGCCGGGGTGGGGGCGGGGAGG + Intergenic
1064418237 10:15168728-15168750 GGGACGGGGCGCGGGCGGGGCGG - Intergenic
1065100369 10:22325578-22325600 GGGCCGGCGCGGGGGCGGGGTGG - Intronic
1065288687 10:24209087-24209109 GGCCCGGGGCTGGGGAGGAGGGG - Intronic
1065342698 10:24722770-24722792 GGACGCCGGCCGGGGCGGAGGGG - Intronic
1065342889 10:24723393-24723415 GGCGCCCGGCGGGGGCGGAGGGG - Intronic
1065590368 10:27256785-27256807 GGAGGGGGGCGGGGCGGGAGCGG - Intergenic
1065590389 10:27256824-27256846 GAAGCGGGGCGGGAGCGGGGGGG - Intergenic
1066012751 10:31209614-31209636 GGGCGGGGGCGGGGGCAGGGCGG - Intergenic
1066370416 10:34814847-34814869 GGCCGGGGGCGCGGGCGGGGAGG - Intronic
1068033499 10:51731992-51732014 GGACGGGGGCGGAGGGGGAGAGG - Intronic
1068697371 10:59982214-59982236 TGCCTGGGGCGGGGGTGGAGGGG + Intergenic
1068866774 10:61903170-61903192 GGACGGGGGCGGGGGAGGGGAGG + Intronic
1069698336 10:70404245-70404267 GGGCGGCGGCGGGAGCGGAGCGG + Intergenic
1069849684 10:71396874-71396896 CGAGCGGGGCGGGGGCCGAGCGG + Intergenic
1069895428 10:71677543-71677565 TGCCCGGGACGGGGGCGGCGAGG + Intronic
1069993717 10:72329955-72329977 GTACTGGGGTGGGGGTGGAGTGG - Intergenic
1070398909 10:76035832-76035854 GAGTCGGGGCGGGGGCGGCGGGG - Intronic
1070877193 10:79825790-79825812 GGGCGGGGGAGGGGGCGGCGGGG + Intergenic
1071086769 10:81875098-81875120 GGGCCGGGGAGGGGGCGGTAAGG - Intergenic
1071643689 10:87341834-87341856 GGGCGGGGGAGGGGGCGGCGGGG + Intergenic
1072021838 10:91410290-91410312 GGGCGCGGGCGGGGGCGGAGTGG + Exonic
1072067332 10:91883915-91883937 GGAACGGGGTGTGGCCGGAGAGG - Intergenic
1072435383 10:95409645-95409667 GGAAGGGGGAGGGGGAGGAGTGG + Intronic
1072451421 10:95542191-95542213 GGACAGGGTGGGGGGCGGTGTGG - Intronic
1072706920 10:97687436-97687458 GGCGCCGCGCGGGGGCGGAGAGG - Intergenic
1072926466 10:99620879-99620901 GGATCGCGTCGGGGGCGGGGCGG + Intergenic
1072970058 10:100009795-100009817 GGAGCCGGGCGGGGGCCGGGCGG - Intronic
1073076682 10:100828908-100828930 GGGGCGGGGCGGAGGGGGAGGGG - Exonic
1073136785 10:101224664-101224686 GGCGCGGGGCGGGGGCCGAGTGG + Intergenic
1073207422 10:101776282-101776304 AGCCCGGGGCGGGGGCGGGGCGG + Intronic
1073217244 10:101843411-101843433 GGGCCAGGCCGGGGTCGGAGAGG + Intronic
1075055548 10:119215625-119215647 GGATGGTGGCGGGGGTGGAGGGG + Intronic
1075368982 10:121918800-121918822 GGGTCGGGGCGGGGGTGGGGGGG + Intronic
1075519762 10:123136481-123136503 GGGACGGGGCGGGCGCGCAGGGG - Intronic
1075583854 10:123643342-123643364 GGGGCGGGGGGGGGGCGGTGAGG - Intergenic
1075841803 10:125511243-125511265 GCACCGCGACGGGGGCGGGGAGG - Intergenic
1075964909 10:126603042-126603064 GGACAGGTGCGGTGGGGGAGGGG + Intronic
1076034795 10:127190666-127190688 GGAACGGGGGGGGGGGGGGGGGG - Intronic
1076246078 10:128948914-128948936 GGGCGGGGGCGGGGGCGGGTGGG - Intergenic
1076362445 10:129898824-129898846 GGGCCTGGGCGCGGGAGGAGGGG - Intronic
1076560550 10:131360466-131360488 GTCCCGGGGCAGGGGCGGTGGGG + Intergenic
1076676355 10:132149569-132149591 GGGGTGGGGCGGGGGCGGAGAGG - Intronic
1076676366 10:132149590-132149612 GGGGTGGGGCGGGGGCGGAGGGG - Intronic
1076676379 10:132149611-132149633 GGGGTGGGGCGGGGGCGGAGGGG - Intronic
1076676391 10:132149631-132149653 AGGGTGGGGCGGGGGCGGAGGGG - Intronic
1076676403 10:132149651-132149673 GGGGTGGGGCGGGGGTGGAGAGG - Intronic
1076722217 10:132397582-132397604 GGGCCGGGGCGGGGGGCGCGGGG + Intronic
1076792824 10:132785985-132786007 GGGCAGGGGCGGCGGCGGCGGGG - Exonic
1076878676 10:133229842-133229864 GAGCCCGGGCGGGGGCGGCGGGG + Intergenic
1076879103 10:133231216-133231238 CGACGGGGGCGCGGCCGGAGGGG - Exonic
1076945053 10:133640827-133640849 GGCTCGGGGAGGGGGAGGAGCGG - Intergenic
1076986014 11:236440-236462 GGACCGGGGCGCCGGGGGCGGGG - Intronic
1077008282 11:369311-369333 GGTGCGGGGCGGGGGGTGAGGGG - Intergenic
1077009219 11:372790-372812 GGGCGGGGGCTGGGGCGGGGGGG + Intronic
1077037969 11:504384-504406 GGGCGCGGGCGGGGGCAGAGAGG - Intronic
1077043732 11:535452-535474 GGGCCGAGGCCGGGGCGGGGCGG + Exonic
1077065534 11:639555-639577 GCGCCGGGGCGCGGGCGGGGAGG - Intronic
1077103658 11:832889-832911 AGGCCGGGGCGGGGCCGGGGCGG + Exonic
1077103662 11:832894-832916 GGGGCGGGGCCGGGGCGGGGCGG + Exonic
1077155636 11:1089692-1089714 GGGCCGGGACGGGGGCTGGGAGG + Intergenic
1077360417 11:2138180-2138202 GGGCCGGGGCTGGGGCGGCGCGG - Intronic
1077378220 11:2215574-2215596 GGACCGGGACGGGCGCTGAGGGG + Intergenic
1077419812 11:2444941-2444963 CGCTCGGGGCGGGGCCGGAGGGG - Intronic
1077488800 11:2851055-2851077 GGACTGGGGTGGGAGCTGAGGGG - Intergenic
1078316081 11:10294242-10294264 GGGTGGGGGCGGGGGAGGAGCGG - Intergenic
1078514344 11:12009361-12009383 GGCTCGGGGCGGGGGCGGAGAGG - Intronic
1078679554 11:13463051-13463073 GGAACTCGGCGGGGGCGGCGCGG - Intronic
1078679816 11:13464968-13464990 GGAGTGGGGCGGGGGTGGGGGGG - Intergenic
1078699722 11:13668924-13668946 GGGCGGGGGCGGGGGCGGGACGG - Intronic
1079250145 11:18781143-18781165 GGGCCGGGGCGGGGCCGGGGGGG - Intronic
1080686953 11:34523949-34523971 GGGCCGGGGGGGTGGCGGACAGG - Intergenic
1080749440 11:35138995-35139017 AGCACGGGGCGGGGGCAGAGGGG + Intronic
1081569153 11:44278820-44278842 GGACCTGGGGAGGGGAGGAGAGG + Intronic
1081789805 11:45774697-45774719 GGACCGGGGTGTTGGCGGCGAGG - Intergenic
1081831960 11:46121654-46121676 GGGCCGCGGCGGGGAGGGAGGGG + Intergenic
1081860843 11:46332737-46332759 GGACCCGGGCGGGGGCGCAGAGG + Intergenic
1082097555 11:48143783-48143805 GGAGAGGGGAGGGGGAGGAGGGG - Intronic
1083246048 11:61429415-61429437 AGGCCGGGGGCGGGGCGGAGCGG - Intronic
1083270085 11:61567801-61567823 GGAGCGGTGAGGGGGCGGCGGGG - Intronic
1083329654 11:61891606-61891628 GGGCCTGGCCGGGGGCGGGGGGG - Intronic
1083389544 11:62337749-62337771 GGTCCGGGCCGGGGGCGGAGAGG + Intronic
1083419944 11:62546884-62546906 GGGGCCGGGCGGGGCCGGAGCGG + Intronic
1083615019 11:64021929-64021951 GGGCCGGGGGGGGGGGGGGGGGG + Intronic
1083652059 11:64209520-64209542 GGACCGGAGAGGGGCCAGAGAGG + Intronic
1083670984 11:64299849-64299871 GGGCCAGGGAGGAGGCGGAGAGG - Exonic
1083721945 11:64607657-64607679 GGTTGGGGGCCGGGGCGGAGGGG + Exonic
1083747713 11:64744866-64744888 GCGCGGGGGCGGGGGCGGGGCGG - Intronic
1083753868 11:64778569-64778591 GGGGCGGGCCGGGGGCGGCGGGG + Intronic
1083801187 11:65047441-65047463 GTACCGAGGCAGGGACGGAGGGG + Intronic
1083883039 11:65557894-65557916 TGCGCGGGGCGGGGGCGGCGGGG - Exonic
1083885771 11:65572837-65572859 CGTCCGGGGCGCGGGCGGCGCGG - Exonic
1083886108 11:65574284-65574306 GGCGCGGGGCGGGGGGGGAGGGG - Intergenic
1083936508 11:65872552-65872574 GGCGCGGGGCGGGGGCGGGGTGG - Intronic
1083939610 11:65888571-65888593 GGGACGGGGCGGGAGCGGCGAGG + Intergenic
1083966923 11:66048940-66048962 AGACCGGGATGGGGGCCGAGAGG - Intronic
1084260982 11:67978388-67978410 GGGCCGGGGGAGGGGGGGAGAGG + Intergenic
1084295757 11:68212940-68212962 GGGCCGGTGCGGGGCCGGCGCGG - Intronic
1084301658 11:68256450-68256472 GGACAGCGGCGGGGGAGGAGCGG - Intergenic
1084336346 11:68460278-68460300 CGGGCGGGGCGGGGGCGGCGGGG - Intergenic
1084397126 11:68919186-68919208 GGACGGGGACGGGGACGGGGAGG - Intronic
1084908637 11:72369411-72369433 GGATGGGGGTGGGGGAGGAGGGG - Intronic
1084946678 11:72642463-72642485 GGGCCGGGGCGGGGCCGGGGCGG - Intronic
1085217920 11:74848569-74848591 GGACTGAGGCGGGGGTGGAAAGG + Intronic
1085321553 11:75577324-75577346 GGGCGGGGGCGGGGGCGGGGGGG - Intergenic
1085465559 11:76721158-76721180 GGACCGGAGTGGGGGCGGGGTGG - Intergenic
1088259124 11:107928353-107928375 GGACGGGGGCGGGGCGGGGGCGG - Intergenic
1088530519 11:110803495-110803517 GGACTGTGGTGGGGGGGGAGGGG - Intergenic
1088604475 11:111514721-111514743 GGGGCGGGGCAGGGGCGGGGCGG + Intergenic
1088823507 11:113475347-113475369 GGGACGGGGCGGAGGCGGCGCGG + Exonic
1089525610 11:119094765-119094787 GGACGGGAGCGGGGGCGGGCGGG + Exonic
1089533843 11:119149198-119149220 GGGCCGGGGCGGGGCAGGCGAGG - Exonic
1089533848 11:119149209-119149231 GGGCCGGGGCGGGGCCGGGGCGG - Exonic
1089616018 11:119695286-119695308 GGACCTGGGAGGGGTGGGAGAGG - Intronic
1089729588 11:120511905-120511927 GGAGCGGGCCGGGGGCGCCGCGG - Intronic
1089729833 11:120512637-120512659 GGGAGGGGGCTGGGGCGGAGGGG + Intronic
1089729837 11:120512643-120512665 GGGCTGGGGCGGAGGGGGAGGGG + Intronic
1090285384 11:125495459-125495481 GGACCGGGGCGGCTGCGCGGTGG - Exonic
1090684095 11:129096520-129096542 GGGGCGGGGCGGGGCCGGGGGGG - Intronic
1090788746 11:130070935-130070957 GGGAGGGGGCGGGGGCGGCGGGG + Intronic
1091241125 11:134053133-134053155 AGACGGGGGCGGGGGGGGGGGGG + Intergenic
1091273049 11:134331740-134331762 GGCCCCGGCCGGGGGCGGGGCGG - Intergenic
1091286589 11:134411858-134411880 GCGCCGGGGCCGGGGCGTAGGGG - Intronic
1091286757 11:134412282-134412304 GGCTCGGGGCGGGGGCGGGGCGG - Intergenic
1091582432 12:1797678-1797700 GGAGCCGGGCGGGGGGTGAGGGG + Intronic
1091583354 12:1801797-1801819 GGACAGGGGCGTGGGTGGAAGGG - Intronic
1091705590 12:2691097-2691119 GGACCGAGCCGGGGGCGAAGAGG + Exonic
1091730594 12:2877328-2877350 GGGCCGGGGAGGGGCCGGAGGGG + Intronic
1091759425 12:3077316-3077338 GGGGCGGCCCGGGGGCGGAGCGG - Intergenic
1091888076 12:4031262-4031284 GGCCCCGGGCGGGGGCGCGGCGG - Intergenic
1092161012 12:6315657-6315679 GGGCCGGGGCTGGGGCTGAGGGG - Intronic
1092214597 12:6672283-6672305 TGTCCGGGGCGGGGGTGGGGAGG + Intronic
1092502839 12:9065155-9065177 GGGCGGGGGCGGGGGGGGGGGGG - Intergenic
1092905986 12:13101177-13101199 GGGGCGGGGCGGGGGCGTAACGG + Intronic
1093547849 12:20369225-20369247 GGGTCGGGGCGGGGGCGTCGGGG + Exonic
1093736541 12:22625870-22625892 GGACTGGGGAGTGGGAGGAGGGG - Intronic
1093931132 12:24956089-24956111 TCCCCGGGGCGGGGGCGGAGGGG - Intergenic
1094041511 12:26125113-26125135 GGAGGGGGGCGGGGGAGGAGGGG + Exonic
1094147328 12:27244231-27244253 GGGGCGGGGCGAGGGCGGAGCGG + Exonic
1094375536 12:29784184-29784206 GGATGGGGGCGGGGGCGTGGGGG - Intronic
1094514841 12:31120323-31120345 AGACCCGGGCGGGGTCGGGGGGG - Intergenic
1094704001 12:32896969-32896991 GGGCGGGGGCGGGGGCGGGCCGG + Intergenic
1095971534 12:47905070-47905092 GGGGCGGGGCGGGGCCGGGGCGG - Intronic
1096094398 12:48925009-48925031 GGGCCGGGGCGGGGCCTGGGAGG - Intronic
1096178601 12:49538889-49538911 GGACCTCGGCGGGGGCGGGGAGG - Intergenic
1096241328 12:49961798-49961820 GGGCCGGCGCGGGGGGGCAGGGG - Intergenic
1096260229 12:50085574-50085596 GGGCCGGGGGCGGGGCCGAGCGG + Intronic
1096336938 12:50764047-50764069 GGGCGGGGGCGGGGGAGGGGAGG - Intronic
1096429906 12:51534394-51534416 GTGGCGGGGCGGGGGCGGGGGGG + Intergenic
1096466291 12:51848939-51848961 GGGGCGGGGCGGGGGCGAGGTGG - Intergenic
1096491366 12:52014910-52014932 GGCGCGGGCCGGGGGCGGCGGGG - Exonic
1096504192 12:52082339-52082361 GGGCTGGGGCGGGGGTGTAGAGG + Intergenic
1096781771 12:53995985-53996007 GAACCAGGGAGGGGGCGGGGAGG + Intronic
1096786804 12:54021542-54021564 GGACCAGAGCGGGGCTGGAGGGG + Intronic
1096814920 12:54196002-54196024 GGACGCGGGCGGGGGCAGTGGGG - Intergenic
1096848063 12:54418785-54418807 GCACCGTGGCGGGTGAGGAGGGG - Intronic
1096870314 12:54588572-54588594 GGGCCGGGGCCGGAGCGGAGCGG - Exonic
1097058606 12:56266124-56266146 GGGGCGGGGCGGGGGTGGTGAGG + Intergenic
1097155912 12:57012325-57012347 GGACTGGGGAGGGGGCTGTGGGG - Intronic
1097190048 12:57215342-57215364 GTGCCGGGGTGGGGGTGGAGAGG - Intergenic
1097222807 12:57460763-57460785 GGAAGGGGGCTGGGGCGGGGGGG + Intronic
1097902171 12:64883890-64883912 GGTCGGGGGCGGGGGGGGGGGGG + Intergenic
1101340958 12:103841372-103841394 GGACGGGGGCGGAGACGGGGCGG + Intergenic
1101371959 12:104138336-104138358 GGGCCGGGGGCGGGGCGGGGCGG - Intergenic
1101371962 12:104138341-104138363 GGGCGGGGCCGGGGGCGGGGCGG - Intergenic
1101371973 12:104138358-104138380 GGACTGGGCCGGGGGCGGGGCGG - Intergenic
1101640377 12:106582605-106582627 GGAGGGGGGCGCGGGCGGGGGGG - Intronic
1102027707 12:109722994-109723016 GGAGCGGGTGGGGGGGGGAGGGG + Intronic
1102151022 12:110689181-110689203 GGACGGGGGCGGGGGCGGCCCGG - Intronic
1102238710 12:111310390-111310412 GGATGGTGGTGGGGGCGGAGCGG + Exonic
1102471396 12:113161792-113161814 GGGCGGGGGCGGGGGCGGGGAGG - Intronic
1102518586 12:113465652-113465674 AGGTCGGGGCGGGGGCGAAGTGG + Intronic
1102768288 12:115451898-115451920 GGCCCGGGGCGAGGGGCGAGCGG + Intergenic
1102810443 12:115819689-115819711 GGATCGTGGTGGGGGCGGAGGGG - Intergenic
1103049437 12:117766878-117766900 GGGATGGGGCGGGGGCGGGGTGG + Intronic
1103363687 12:120368411-120368433 GGAACGGGGCGAGGGCGGTGGGG - Intronic
1103386265 12:120534760-120534782 GGAGCGGAGCGGGCGCGGCGGGG - Exonic
1103410789 12:120710370-120710392 GGGGCGGGGAGGGGGCGGGGCGG - Intergenic
1103520764 12:121536069-121536091 GGAATGGGGCGGGGACGGACAGG + Intronic
1103534779 12:121626869-121626891 GGACGGCGGCGGTGGCGGGGCGG - Exonic
1103623697 12:122203890-122203912 GGACCGGGGAGCGGGCCGCGGGG - Intronic
1103700661 12:122847294-122847316 TAGCCGGGGCGGGGGGGGAGGGG + Intronic
1103807541 12:123584881-123584903 GGACCGGCGCGGGGCCTGTGTGG + Intronic
1103856078 12:123972441-123972463 GGGGCCGGGCAGGGGCGGAGGGG - Intronic
1103905943 12:124327196-124327218 GGGCCGGGGCTGGGGGGCAGAGG + Intronic
1103965614 12:124637642-124637664 GGACAGGGGTGGGGGTGGTGAGG - Intergenic
1103990758 12:124797763-124797785 GGGCTGGGGCCGGGGCCGAGAGG + Intronic
1104001636 12:124863975-124863997 GGCCCGGGGCGGGGTCGGGGCGG + Intronic
1104001644 12:124863986-124864008 GGGTCGGGGCGGGGACGGGGCGG + Intronic
1104140130 12:125979666-125979688 GGGCCGGGGGGGGGGGGGTGGGG + Intergenic
1104376194 12:128267113-128267135 GGGCGGGGCCGGGGGCGGGGCGG + Intergenic
1104656311 12:130576124-130576146 GGACAGGTGAGGGGGAGGAGGGG + Intronic
1105011770 12:132761410-132761432 TTCCCGGGCCGGGGGCGGAGGGG - Intronic
1105295675 13:19086341-19086363 GGACTGGGGCGGGGGCGGGGAGG - Intergenic
1105453237 13:20518745-20518767 GGACCAGGACGGAGGCAGAGGGG + Intronic
1105699575 13:22926352-22926374 GGGCCTGGGCCGGGGCGGGGCGG + Intergenic
1105850301 13:24328333-24328355 GGACCGCGGCAGAGGCGGCGCGG - Intergenic
1105943551 13:25171217-25171239 CGACAGCGGCGGGGGCGGCGGGG - Exonic
1105964526 13:25372321-25372343 GGCCCGGGGCGGGGGCGGCGCGG + Intronic
1106264866 13:28100682-28100704 GGACCGAGGCGGGAGCGGAGAGG + Intergenic
1106294189 13:28395022-28395044 GGACAGGGTAAGGGGCGGAGAGG + Intronic
1106447585 13:29850355-29850377 AGACCGGGGAGGCGGCGGCGGGG - Exonic
1106517169 13:30465412-30465434 GGAGCGCGGCCGGGGCGGCGGGG - Intronic
1106735792 13:32586779-32586801 GGCCCGGGGCGGGGGTCGCGGGG + Intronic
1106735866 13:32587017-32587039 CGGCCGGGGCGCGGGGGGAGGGG - Intronic
1107414348 13:40187314-40187336 GGGCCGGGGAGGGGGGGGTGGGG + Intergenic
1107446131 13:40471718-40471740 GGACTGGGGCCTGGGCAGAGGGG + Intergenic
1107605212 13:42049162-42049184 GGCCTGGGGCGCGGGCGGGGCGG + Intronic
1108350347 13:49585651-49585673 GGGCCGGGGCCGGGGCGGTGCGG - Intergenic
1108409235 13:50130389-50130411 GGGGCTGGGCGGGTGCGGAGGGG + Intronic
1108484352 13:50909728-50909750 GGAGCGGGGCGGGGTCGCCGGGG - Exonic
1110318202 13:74134290-74134312 GGGCGGGGGCGGCGGCGGGGAGG + Intergenic
1110573145 13:77027221-77027243 GGAAGGGGGCGGGGGGGGGGCGG + Intergenic
1110735278 13:78928794-78928816 GGGCCGGGGCGGGGGGGGGGAGG - Intergenic
1110855948 13:80296825-80296847 GGGGCGGGGAGGGGGAGGAGCGG + Intergenic
1111951791 13:94713577-94713599 GGAGGGGGCGGGGGGCGGAGGGG - Intergenic
1112290647 13:98142520-98142542 GGACGTGGGCGGGCGCGGGGTGG + Intergenic
1112435443 13:99388600-99388622 GGGCCTGGGCGAGGGCAGAGTGG + Intergenic
1112503071 13:99957049-99957071 GGCGCGGGGCGCGGGCGGCGGGG - Intergenic
1112506992 13:99981406-99981428 TGACCGCGGCGGGGGCGCCGGGG - Intergenic
1112560256 13:100506381-100506403 GGGTGGGGGCGGGGGCGGCGGGG + Intronic
1112563258 13:100532273-100532295 GGACCGGGCCCCGGGCGCAGAGG - Exonic
1113312032 13:109140990-109141012 GGGCGGGGGCGGGGGCGGCGTGG - Exonic
1113571441 13:111361102-111361124 GGACCGGGGTGGGAGGGGAATGG + Intergenic
1113602999 13:111584323-111584345 GGACTGGGGCGGTGGCAGCGGGG - Intergenic
1113768302 13:112894248-112894270 GCCCGGGGGCGGGGGCGGGGCGG - Intergenic
1113768326 13:112894291-112894313 GGGGCGGGGCGGGGGCGGGCCGG - Intergenic
1113794738 13:113050658-113050680 GGGCCGGGGCGGTGGAGGGGGGG + Intronic
1113794772 13:113050717-113050739 GGGCGGGGGCGGGGGGGGCGGGG + Intronic
1113861461 13:113490368-113490390 GGGCAGGGGCCGGGGCCGAGCGG - Intronic
1113946081 13:114044420-114044442 GGGGCGGGGGGGGGGCGGGGGGG - Intronic
1114083459 14:19220329-19220351 GGAACGGGGTGGGTGCCGAGGGG + Intergenic
1114270643 14:21098249-21098271 GGCCGGGGGCGGGGGCCGGGTGG + Intronic
1114270708 14:21098429-21098451 GGGCCGGGCCGGGGGCGGGGGGG - Exonic
1114318238 14:21526016-21526038 GGGCAGGGGTGGGGGCGGAGGGG - Intronic
1114477941 14:23010864-23010886 GGGTGGGGGTGGGGGCGGAGGGG - Intergenic
1114664558 14:24370036-24370058 GGCCCGGGGCGAGGGCAGCGGGG - Exonic
1114865998 14:26597145-26597167 GGCGCGGGGCAGGGGCGCAGGGG + Intronic
1115566640 14:34630193-34630215 GGGGCGGGGCGGAGGCGAAGGGG + Intergenic
1115689222 14:35826375-35826397 GGCCCGGGCCGGGGGCGGGGAGG + Exonic
1115752915 14:36508369-36508391 GAACCTGGGCAGGGGCGGGGCGG + Intronic
1115758864 14:36557957-36557979 GGGCTGGGGGTGGGGCGGAGGGG - Intergenic
1116657001 14:47665815-47665837 GGGGTGGGGCGGGGGCGGGGGGG - Intronic
1116817920 14:49599937-49599959 GGGCCGGGGCGGGGGCTCCGGGG + Intronic
1116835802 14:49768219-49768241 GGAGCCGGGCGGCGGCGGCGCGG - Exonic
1116973560 14:51093685-51093707 GGACTGGGATGGGGGCGGTGGGG - Intronic
1117548019 14:56809038-56809060 GGGGCCGGGCGGGGGCCGAGGGG - Intronic
1117690339 14:58299189-58299211 GGAGGGGGCGGGGGGCGGAGGGG - Intronic
1117781678 14:59239627-59239649 GGATCGGGGTGGGGGCGCGGTGG - Intronic
1118339147 14:64879999-64880021 GTCCCGCGGCGGGGGCGGGGAGG + Intergenic
1118366764 14:65102728-65102750 GGAGGGGGGGGGGGGCGGGGGGG + Intergenic
1118576000 14:67241590-67241612 GGAGCGCGGCGGGGGAGGGGCGG + Intronic
1118776846 14:68978818-68978840 GGGAGGGGGCGGGGGCGGTGCGG - Intronic
1118916211 14:70108809-70108831 GGACTGTGGCTAGGGCGGAGAGG - Intronic
1118971673 14:70642546-70642568 GGACCGCGGCGCGGGGGGCGCGG - Intronic
1119286382 14:73458342-73458364 GGGCCAGGGCGGAGGCGGCGGGG - Intronic
1119377459 14:74206366-74206388 GGAGGGGGGAGGGGGAGGAGTGG - Intergenic
1119392792 14:74302680-74302702 GGGCCGCGGCCGGTGCGGAGCGG + Intronic
1119507151 14:75182778-75182800 GGAGCGGGGTGGGGGAAGAGGGG - Intergenic
1119522165 14:75294366-75294388 GGACCGGGGGCGGGGCGCGGCGG - Intergenic
1119539182 14:75427874-75427896 GGACCGGGGAGGAGGGGGTGTGG - Intronic
1119750862 14:77076470-77076492 GGTCAGGGGCGGGGGAGGGGCGG - Intergenic
1120190553 14:81436218-81436240 GGGCGGGGGCGGGGGCGGGCCGG - Intronic
1120426253 14:84351500-84351522 GGTCCTGGGCTGGGGCGGAAGGG + Intergenic
1121410575 14:93745977-93745999 GGATGGGGGCAGCGGCGGAGGGG - Intronic
1121464407 14:94105456-94105478 GGGCAGGGGGAGGGGCGGAGCGG - Intronic
1121472511 14:94166213-94166235 GGGGCGGTGCGGGGGCGGGGGGG - Intronic
1121473468 14:94174294-94174316 GGCCCGGCGAGGGGGCGGGGCGG - Exonic
1121879435 14:97486912-97486934 GGGCGAGGCCGGGGGCGGAGTGG + Intergenic
1122065993 14:99174885-99174907 GGACGCGGGCGCGGGCGGCGCGG - Exonic
1122145055 14:99684126-99684148 GGGCCTGGGCTGGGGCGGTGTGG + Intergenic
1122159605 14:99773762-99773784 GGACCTGGGCAGGGCCGGGGAGG - Intronic
1122516849 14:102314824-102314846 GGGCCAGGGAGGAGGCGGAGGGG + Intergenic
1122546307 14:102524626-102524648 GGTCCGGGGCGGAGGCGGGGAGG - Intergenic
1122626062 14:103085872-103085894 GGGCCTGGGCTGGGGTGGAGTGG + Intergenic
1122690730 14:103531088-103531110 AGAGTGGGGCAGGGGCGGAGAGG - Intronic
1122707388 14:103629631-103629653 GTACCGGGGTGGGAACGGAGAGG - Intronic
1122721978 14:103727378-103727400 GGCACGGGGACGGGGCGGAGGGG - Intronic
1122840764 14:104461605-104461627 GGACGGGGGACGGGGCGGGGCGG + Intergenic
1122840771 14:104461616-104461638 GGGGCGGGGCGGGGGCGGGGCGG + Intergenic
1122904550 14:104795766-104795788 GGCGCGGGGCGGGCGCGGGGCGG - Intergenic
1122931160 14:104933598-104933620 GGACAGGGGCGGCGCGGGAGGGG + Exonic
1122945768 14:105008186-105008208 GGGGCGGGGCGGGGTGGGAGGGG - Intronic
1122975008 14:105167523-105167545 GGGTCGCGGCGGGGGCGGGGCGG - Intronic
1123023126 14:105411519-105411541 GGGGCGGGGCGGGGACGGGGCGG - Intronic
1123036556 14:105474217-105474239 GGGCGCGGGCGGGGGCGGAGCGG + Intronic
1202841358 14_GL000009v2_random:124598-124620 GGACCCTGGCGGGGGCTGGGAGG - Intergenic
1202910747 14_GL000194v1_random:114829-114851 GGACCCTGGCGGGGGCTGGGAGG - Intergenic
1202926222 14_KI270724v1_random:28426-28448 GGCTCGGGGAGGGGGAGGAGCGG + Intergenic
1123495197 15:20816954-20816976 GGTCCTGGCCCGGGGCGGAGGGG + Intergenic
1123551689 15:21386047-21386069 GGTCCTGGCCCGGGGCGGAGGGG + Intergenic
1123739866 15:23226147-23226169 GGTCGGGGACGGGGGCGGGGCGG - Intergenic
1123849754 15:24342874-24342896 GGGCTGGGCGGGGGGCGGAGTGG - Intergenic
1123998494 15:25734999-25735021 GGAGCGGGGGGGGGGTGGGGGGG + Intronic
1124226815 15:27901973-27901995 GGTCCTGGCAGGGGGCGGAGGGG + Intronic
1124291734 15:28457543-28457565 GGACCAGGCCGGGGGCCGGGGGG - Intergenic
1124496785 15:30192061-30192083 GGGCGGGGGCGGGGGCGGCTGGG + Intergenic
1124640023 15:31391596-31391618 GGGCGGGGGCGGGGGCGGGGTGG - Intronic
1124640357 15:31392812-31392834 GGGCGGGGGCGGGGGCGGGGTGG - Intronic
1124746791 15:32346586-32346608 GGGCGGGGGCGGGGGCGGCTGGG - Intergenic
1124983659 15:34584745-34584767 AGACGGGGGGGGGGGCGGGGGGG + Intronic
1125024761 15:35019363-35019385 GGGGCGGGGCGGGGGCGGGGAGG - Intergenic
1125024772 15:35019382-35019404 GGAGCGGGGGGGGGGGGGGGGGG - Intergenic
1125594247 15:40874092-40874114 GGCCCGGAGCGGGGGCGGCTCGG + Exonic
1125929499 15:43590140-43590162 GGCCGGGGGCGGTGGGGGAGTGG - Intronic
1125942666 15:43689972-43689994 GGCCGGGGGCGGTGGGGGAGTGG - Intergenic
1126109483 15:45167146-45167168 CAGCCGGGGCGGGGGCGGCGGGG + Intergenic
1126113388 15:45187995-45188017 GGGCGGGGGCGGGGGTGGGGAGG + Intronic
1126195800 15:45929276-45929298 GGGCGGGGGTGGGGGCGGAGGGG + Intergenic
1126940390 15:53759722-53759744 GGACCGGGGCGGGGCGGGGCGGG - Intronic
1127295115 15:57602181-57602203 AGACTGGGACGGGGGTGGAGAGG + Intronic
1127606216 15:60591508-60591530 GGCCGGGGGCGGGAGGGGAGGGG - Intronic
1127732865 15:61816392-61816414 GGACCGGGAAGGGGGAAGAGAGG + Intergenic
1127850194 15:62905261-62905283 GTACCGGGCCGGGGCCGGGGAGG - Intergenic
1128078238 15:64841634-64841656 GGGCTGCGGCGGGGGAGGAGAGG - Intergenic
1128078306 15:64841812-64841834 GGGCCGGGGAGGGGGCGGTGGGG - Intergenic
1128078314 15:64841823-64841845 GGGCCGGGGCGGGGCCGGGGAGG - Intergenic
1128501422 15:68229739-68229761 GGACCCGGGGCGGGGCGGAGCGG + Exonic
1128547733 15:68579183-68579205 GGCCCGGGGCGGCGGCGGAAGGG - Exonic
1128955655 15:71940499-71940521 GGACGGGGTTGGGGGAGGAGGGG + Intronic
1128999446 15:72320049-72320071 GGAAAGGGGCGGGGCCGGGGCGG + Exonic
1128999449 15:72320054-72320076 GGGGCGGGGCCGGGGCGGGGCGG + Exonic
1129120686 15:73394662-73394684 GGACTGGGGAGGAGGGGGAGAGG - Intergenic
1129162238 15:73753212-73753234 CGGCCGGGGCGCGGGCGGCGCGG - Intergenic
1129287970 15:74541154-74541176 GGGCGGGGGCGGGGGCGGGGCGG - Intergenic
1129351269 15:74957149-74957171 TCCCCGGGGCGGGGGAGGAGGGG - Exonic
1129414610 15:75368341-75368363 GGGCAGGGGCCGGGGAGGAGGGG - Intronic
1129468497 15:75737686-75737708 GGGCGGGGGCGGGGGCGGGGTGG + Intergenic
1129483342 15:75844185-75844207 GGACCGGGGCGGGGCGGGGCGGG + Intronic
1129644412 15:77417450-77417472 GATGCGGGGCGGGGGGGGAGGGG + Intronic
1129658729 15:77541523-77541545 GGACCGGGGCAGGGCTGGGGAGG - Intergenic
1130270768 15:82445777-82445799 GGGGCAGGGCGAGGGCGGAGAGG + Intergenic
1130370598 15:83283420-83283442 GGAGCCGGGCGGCGGCGGCGAGG - Intronic
1130370939 15:83284761-83284783 GGGCAGGGGGAGGGGCGGAGAGG - Intergenic
1130463110 15:84173100-84173122 GGGGCAGGGCGAGGGCGGAGAGG + Intronic
1130489564 15:84421688-84421710 GGGGCAGGGCGAGGGCGGAGAGG - Intergenic
1130501155 15:84500450-84500472 GGGGCAGGGCGAGGGCGGAGAGG - Intergenic
1131060335 15:89400257-89400279 GGGCCGGGGAGGGGGTGGAGGGG + Intergenic
1131119629 15:89814441-89814463 GGACGGGGAGGGCGGCGGAGCGG - Intronic
1131701553 15:94942651-94942673 GGGCGGGGGCGGGGGGGGGGAGG - Intergenic
1132099861 15:99015411-99015433 GGAAGGTGGCGGGGGCGGAAGGG - Intergenic
1132343100 15:101090321-101090343 GGATCGTGGCTGGGGCAGAGTGG + Intergenic
1202960031 15_KI270727v1_random:113289-113311 GGTCCTGGCCCGGGGCGGAGGGG + Intergenic
1132475947 16:138278-138300 GGCCGGGGCCGGGGGCGGAGGGG + Exonic
1132475960 16:138310-138332 GGACGGAGCCGGAGGCGGAGGGG + Exonic
1132475972 16:138342-138364 GGACGGAGCCGGAGGCGGAGGGG + Exonic
1132475998 16:138405-138427 GGGCAGGGGTGGAGGCGGAGGGG + Exonic
1132476012 16:138437-138459 GGGCAGGGGTGGAGGCGGAGGGG + Exonic
1132476026 16:138469-138491 GGGCAGGGGTGGAGGCGGAGGGG + Exonic
1132476040 16:138501-138523 GGGCAGGGGTGGAGGCGGAGGGG + Exonic
1132476053 16:138533-138555 GGGCAGGGGTGGAGGCGGAGGGG + Intronic
1132476067 16:138565-138587 GGGCAGGGGTGGAGGCGGAGGGG + Intronic
1132499894 16:280612-280634 CGAGCGGGGCGGCGGCGGGGCGG + Exonic
1132519903 16:382125-382147 GGACCGGGGCGCGCGCGGTCCGG + Intronic
1132557499 16:579006-579028 CGAGTGGGGCGGGGGCGGGGCGG + Intronic
1132575239 16:660998-661020 GGGCCGGGGGGGGGGGGGGGCGG - Intronic
1132585993 16:705954-705976 GGGCCGGGGCGGGGCGGGGGCGG - Intronic
1132645314 16:996818-996840 GGGCTGGGGCGGGGGCAAAGGGG + Intergenic
1132683450 16:1153023-1153045 GGGCGGGGCCGGGGGCGGGGCGG - Intergenic
1132683467 16:1153049-1153071 CGACCGGGGCGGGGCCAGCGTGG - Intergenic
1132698435 16:1212204-1212226 AGGCCGGGGCGGGAGTGGAGGGG - Intronic
1132704392 16:1236886-1236908 AGGGCGGGGCGGGGGCGGGGAGG + Intergenic
1132707124 16:1249539-1249561 AGGGCGGGGCGGGGGCGGGGAGG - Intergenic
1132734601 16:1379300-1379322 GGAGCGGAGCGGGGCAGGAGAGG - Intronic
1132831244 16:1929536-1929558 GGGCGGGGGCGGGGGTGGCGCGG - Intergenic
1132879569 16:2155968-2155990 GGGCCGGGGCGGGGAGGGGGGGG + Intronic
1132887781 16:2190023-2190045 GGGCAGGGGCGGGGGCAGCGAGG - Intronic
1132889495 16:2196779-2196801 GTCCCGGGGCGGGCGCGGGGAGG - Intergenic
1132897744 16:2236964-2236986 GGGCCCGGGCCGGGGCGGGGCGG + Intronic
1132987815 16:2777187-2777209 GGGCCGGGCCGGGGGCGGCGGGG - Intronic
1133032929 16:3020313-3020335 AGGCGGGGGCGGGGGCGGGGCGG + Exonic
1133220172 16:4316285-4316307 GGACCGGGCCGGGGCGGGGGGGG + Intronic
1133220178 16:4316290-4316312 GGGCCGGGGCGGGGGGGGGGGGG + Intronic
1133732610 16:8589887-8589909 GGACGGGGGCAGGAGCAGAGGGG - Intergenic
1133784437 16:8963608-8963630 GGGCCGGGGCCGGGGCTGCGGGG + Intronic
1134031891 16:10998756-10998778 GGACCAGAGCAGGGGCGGACAGG - Intronic
1134050257 16:11132236-11132258 GGATGGGGGCGGGGGCGGGGGGG - Intronic
1134198532 16:12178219-12178241 GGACCGGGGCATGGGCTGATGGG + Intronic
1134235049 16:12459059-12459081 GGACCGGGGAGGAGGAGGTGGGG - Intronic
1134299333 16:12975647-12975669 GGACGGGGGCGGGGGGGGTAAGG + Intronic
1134567868 16:15266664-15266686 TGCCCGGGGCTGGGGCTGAGGGG - Intergenic
1134734567 16:16489689-16489711 TGCCCGGGGCTGGGGCTGAGGGG + Intergenic
1134849806 16:17470646-17470668 GGAGCGCCGCGGGGGCGCAGCGG - Exonic
1134849911 16:17470980-17471002 GGACGCGGGCCGAGGCGGAGAGG + Intergenic
1134932899 16:18222217-18222239 TGCCCGGGGCTGGGGCTGAGGGG - Intergenic
1135335805 16:21599915-21599937 GGGCCGGGGCGGGGGCGTGGCGG + Intronic
1135537085 16:23302609-23302631 TGAACGGGTTGGGGGCGGAGGGG + Intronic
1135573277 16:23565852-23565874 GGACGGGGGCGCAGGGGGAGGGG - Intronic
1135821848 16:25692252-25692274 GGCCAGGGCCGGGGGCGCAGCGG + Exonic
1136241826 16:28949374-28949396 AGGCCAAGGCGGGGGCGGAGGGG + Intergenic
1136454029 16:30370296-30370318 GGCGCGCGCCGGGGGCGGAGCGG + Intergenic
1136497814 16:30654779-30654801 GGACGGGGGTGGGGGCTGTGGGG - Exonic
1136550489 16:30980006-30980028 GGCGCGGGGCGGTGGCGGCGGGG - Exonic
1136625324 16:31458761-31458783 GGGGCGGGGCGGCGGGGGAGCGG - Intronic
1136707669 16:32202523-32202545 GGACGGGGGCGGGGGCGGAGCGG + Intergenic
1136760241 16:32726887-32726909 GGACGGGGGCGGGGGCGGAGCGG - Intergenic
1136807863 16:33143499-33143521 GGACGGGGGCGGGGGCGGAGCGG + Intergenic
1137031977 16:35532414-35532436 TGAGGGGGGCGGGGGCGGAATGG - Intergenic
1137677769 16:50312205-50312227 GGGCTGGGGCGGGGGCAGGGAGG + Intronic
1137738377 16:50742019-50742041 GGGAGGGAGCGGGGGCGGAGGGG - Intergenic
1138071566 16:53997566-53997588 GGGGCGGGGCGGGGTGGGAGTGG + Intronic
1138234470 16:55370176-55370198 GGAGAGGGGCGGGGATGGAGGGG + Intergenic
1138327890 16:56191106-56191128 GGGCGGGGGCGGAGGCGGGGTGG + Intergenic
1138370030 16:56519643-56519665 GGCTGGGGGCGGGGTCGGAGAGG + Intronic
1138390034 16:56663349-56663371 TGTGCGGGGCGGGGGGGGAGGGG - Intronic
1138398890 16:56730016-56730038 GGGCGGGGCCGGGGGCGGGGCGG - Intronic
1138442532 16:57043614-57043636 GGGCAGGGCTGGGGGCGGAGAGG - Intronic
1138619263 16:58198234-58198256 GTGCCGGGGCGGGGCCGGGGCGG - Intergenic
1139352011 16:66342828-66342850 GGAACGGGGAGGTGGCGGGGGGG - Intergenic
1139544785 16:67645085-67645107 GGGCCGGGCCGGGGGCGGCCTGG + Exonic
1139774892 16:69311098-69311120 GGGCGGGGCCAGGGGCGGAGCGG - Intronic
1140063773 16:71592737-71592759 GGACCTGGGAGGGGGCAAAGTGG - Intergenic
1140223119 16:73058205-73058227 GGCGCGGGGCCGGGGAGGAGGGG + Intronic
1140902572 16:79383216-79383238 GGACTGGGGTGGGGGCAGGGTGG + Intergenic
1141132330 16:81444891-81444913 GCGCCGGGGTGGGGGCGGCGGGG - Intergenic
1141172103 16:81697992-81698014 GGGTGGGGGCGGGGGCGGGGGGG - Intronic
1141289068 16:82700962-82700984 TGCCCGGGGCGGGGGGGGGGGGG - Intronic
1141464444 16:84196777-84196799 GGACCGGGACGGGGGGAGGGTGG - Intronic
1141828635 16:86497619-86497641 GGCCGGGGGCGGGGGCGGGGCGG - Intergenic
1141989719 16:87602869-87602891 GGACCGGAGGGGAGGGGGAGGGG - Intronic
1142028576 16:87827273-87827295 GCCCCGGGACGGGGGCGGATGGG + Intergenic
1142120466 16:88384022-88384044 GGTCCCCGGCGGGGGCGGGGGGG + Intergenic
1142140803 16:88471931-88471953 GGGCCGGGGCAGGGGCCGTGTGG + Intronic
1142142752 16:88479826-88479848 GGACGGGGAGGGGAGCGGAGAGG - Intronic
1142173574 16:88634909-88634931 GGAAGGAGGCGGGGGCGGAGCGG + Intergenic
1142271867 16:89094018-89094040 GGACCGCGGCGGGGTCGGCCGGG + Intronic
1142285866 16:89171353-89171375 GGGCCGGGGTGGGGCCGGGGCGG - Intergenic
1142348337 16:89568412-89568434 GGAACGAGGCGGGGGCTGATGGG + Intergenic
1142401968 16:89863651-89863673 GGTCAGGGGCGGGTGCCGAGAGG + Intronic
1203062395 16_KI270728v1_random:987209-987231 GGACGGGGGCGGGGGCGGAGCGG - Intergenic
1142550122 17:732938-732960 GGAGCGGGGCCGGGGCGGGCGGG + Intronic
1142587002 17:979926-979948 GGGGCGTGGCGAGGGCGGAGGGG - Intergenic
1142623714 17:1179880-1179902 GGGCAGGGGCGAGGGCGGGGCGG + Intronic
1142670562 17:1485808-1485830 GGGCCCGGGTGGGGGCGGTGCGG - Intronic
1142683349 17:1562685-1562707 CGACCGCGGCGAGGGCGGCGGGG - Exonic
1142688596 17:1591716-1591738 GGACGGGGTGGGGGGGGGAGGGG + Intronic
1142836850 17:2593848-2593870 GGCCCGGGGAGGGGGAGGGGAGG - Exonic
1142848144 17:2691954-2691976 GGGGCGGGGCGGGGGCGTGGCGG - Intronic
1142848149 17:2691965-2691987 TGGCGGGGGCGGGGGCGGGGCGG - Intronic
1142876387 17:2853898-2853920 GGGCCGGGGCGCGGGCTCAGGGG + Intronic
1142993562 17:3747822-3747844 GGACTGGGGCGGGGGGTGGGTGG - Intronic
1143478200 17:7214750-7214772 GGGGAGGGACGGGGGCGGAGTGG + Intronic
1143495018 17:7307821-7307843 GGGTCGGGGAGGGGGCAGAGGGG + Intronic
1143499213 17:7329245-7329267 GGACCGGGGCCGGGCGGGGGTGG - Exonic
1143584187 17:7843254-7843276 GTACCGAGGCAGGGGCGGGGAGG - Intronic
1143702409 17:8671001-8671023 GGCGTGGGGCGGGGGCGGGGGGG + Intergenic
1143702413 17:8671007-8671029 GGGCGGGGGCGGGGGGGGGGCGG + Intergenic
1143904691 17:10198916-10198938 GGGCCGGGGCGGGGCCAGGGCGG + Intergenic
1144062869 17:11598981-11599003 GGACGGAGGCGGGGCCAGAGGGG + Intronic
1144109969 17:12021360-12021382 GGCTCGGGGCTGCGGCGGAGCGG + Intronic
1144131550 17:12251405-12251427 GGCCAGGGGTGGGGGTGGAGGGG + Intergenic
1144635407 17:16904504-16904526 GGAACGGGGCGGAGGCAGAATGG - Intergenic
1144775767 17:17783775-17783797 GGCGGGGGGCGGGGGCGGAAAGG + Intronic
1144851687 17:18247131-18247153 GGACCGGGGCGCGGGGGGGGGGG - Intronic
1144854076 17:18258496-18258518 GGACTGCGGCCGGGGCGGGGTGG - Intronic
1145190832 17:20841571-20841593 GGACCAGGCCGGGGGCCGGGGGG + Intronic
1145980123 17:29006079-29006101 GGGCGGGGGCGCGGGAGGAGCGG + Exonic
1146166469 17:30593646-30593668 AGACCAAGGCGGGGGCGGGGGGG + Intergenic
1146179375 17:30687538-30687560 GGCGCGGGGCGGGGGTGGGGTGG - Intergenic
1146382593 17:32341942-32341964 GGCCGGGGGCGGGGCCGCAGGGG + Intronic
1146398681 17:32487365-32487387 GGCCCGGGACTGGGGCGGCGGGG + Intronic
1147193449 17:38749825-38749847 GGACGGGGGCGGGGAGGAAGAGG + Exonic
1147258830 17:39197200-39197222 GGAGCGGGGAGGGGGCGGGTGGG - Intronic
1147285917 17:39402301-39402323 GCACTGGGGCGGGGGAGGCGGGG - Intronic
1147315344 17:39617765-39617787 GGCGCGGGGCGGGGGTGGCGAGG - Intergenic
1147393136 17:40122224-40122246 GGGCCGGGGCGGGGAAGGGGGGG + Intergenic
1147620663 17:41864780-41864802 GGAGGGCGGCGGGCGCGGAGAGG - Intronic
1147627105 17:41907393-41907415 GGACTGGGGGGAGGGCGGTGGGG - Intronic
1147897448 17:43759874-43759896 GGGCCGGGGCGGGGGGCGGGGGG + Intergenic
1147947249 17:44086977-44086999 GGGTGGGGGCGGGGGCGGGGTGG + Intronic
1148021670 17:44557632-44557654 GGTTGGGGGCGGGGGCGGGGGGG + Exonic
1148108692 17:45132581-45132603 GGAAGGGGGCGGGGCCGGGGCGG + Exonic
1148337480 17:46851444-46851466 GGGGCGGGGCGAGGGCGGTGGGG + Intronic
1148432136 17:47650570-47650592 GGACCGGGTTGGGGGGGGAGGGG - Intronic
1148553503 17:48564422-48564444 GGGCGGGGGCGGGGGCGGGGTGG - Intronic
1148555834 17:48578059-48578081 GGGCGGTGGCGGGGGCGGCGGGG + Exonic
1148602069 17:48901768-48901790 AGACGGGGGCGGGGGTGGGGGGG - Intergenic
1148616436 17:49004059-49004081 GGACTGGCGCGGGGGCGGGCGGG - Intronic
1148618468 17:49016907-49016929 GAAAGGGGGCGGGGGCGGGGAGG - Intronic
1148785960 17:50146342-50146364 GGAGCCAGGCGGGGGCGGGGAGG + Intronic
1148830204 17:50426190-50426212 GGGGCGGGGCGGGCGCGCAGCGG - Exonic
1148865469 17:50626093-50626115 GGCCCGGGCCAGGGGCGGGGAGG - Exonic
1149614438 17:57987272-57987294 GGCCCGGGGCAGGCGGGGAGCGG - Intronic
1150210401 17:63438442-63438464 GGGCGGGGGCGTGGGGGGAGCGG - Intronic
1150217208 17:63477354-63477376 GGGCCCGGGCGGGGGCGGGGCGG + Intergenic
1150249936 17:63699787-63699809 GGGCCAGGTCGGGGGCCGAGGGG - Intronic
1150373673 17:64662386-64662408 GGGGCGGGGCGGGGCCGGGGCGG + Intergenic
1150488660 17:65560558-65560580 CGGCAGTGGCGGGGGCGGAGAGG - Intronic
1150488886 17:65561295-65561317 GGAGGGGGGCGCGGGCGGGGCGG - Intronic
1150562055 17:66302771-66302793 GGGCGGGGGCGGCGGGGGAGAGG - Intronic
1151210462 17:72540469-72540491 GGGCGCGGGCGCGGGCGGAGCGG - Intergenic
1151218371 17:72592863-72592885 GGAGCGGGGTGGGCGGGGAGGGG + Intergenic
1151326189 17:73380964-73380986 GTGCCGGGGCGGGGGCGCAGAGG + Intronic
1151354711 17:73551450-73551472 GGAATGGGGAGGGGGCGGAGCGG + Intronic
1151437392 17:74106324-74106346 GGACATGGGCGGGGGGGGGGGGG + Intergenic
1151453732 17:74214218-74214240 AGGCCGGGGCTGGGGAGGAGGGG - Intronic
1151511915 17:74566006-74566028 GGGGCGGGGAGGGGGCGGGGGGG + Intergenic
1151543228 17:74776131-74776153 GGTCGGGGGCGGGGAGGGAGTGG - Intronic
1151570499 17:74923265-74923287 ACCCGGGGGCGGGGGCGGAGGGG + Intergenic
1151580087 17:74972668-74972690 GGGCGGGGGCCGGGCCGGAGCGG - Exonic
1151711419 17:75809090-75809112 GGGCGGGGGCGGGGGCGGGGGGG + Intronic
1151744974 17:76007120-76007142 GGACGGTGGGGGAGGCGGAGCGG + Exonic
1151783727 17:76265227-76265249 GGAGCCGGGCGCTGGCGGAGCGG + Exonic
1151889954 17:76946118-76946140 GGACCTGGGAGGGGGTGGGGAGG + Intronic
1151939032 17:77281373-77281395 GGGCGGGGGCGGGGCCGGGGCGG + Intronic
1152364047 17:79844899-79844921 GGGCCCGGGCAGGGGCGCAGAGG + Intergenic
1152468077 17:80476797-80476819 AGGCGGGGGCGGGGGAGGAGGGG - Intronic
1152564770 17:81095401-81095423 GGGCCGGTGCGGGGACGGGGAGG - Intronic
1152570456 17:81119241-81119263 GGAGCGGGGCCGGGAAGGAGCGG + Intronic
1152581195 17:81166246-81166268 GGAGCGGCGCGGGGGAGGGGGGG + Intergenic
1152623955 17:81379947-81379969 GGAGCGGGGTGTGGGGGGAGCGG - Intergenic
1152631318 17:81411834-81411856 GGGCAGGGGCCGGGGCGGTGAGG - Intronic
1152720849 17:81923263-81923285 GGCCGGGGGCGGGGGGGGGGGGG - Intronic
1152720855 17:81923269-81923291 GAACTGGGCCGGGGGCGGGGGGG - Intronic
1152721805 17:81927246-81927268 GGAGCCGGGCGAGTGCGGAGCGG - Intronic
1152721918 17:81927545-81927567 GGGCCGAGGCCGGGGCGGGGCGG + Exonic
1152744171 17:82031574-82031596 GGGCGGGGGCGGGGGCGGGCGGG - Intergenic
1152853085 17:82648801-82648823 GGGGCGGGGCGGAGGCGGGGAGG + Intergenic
1152870626 17:82751563-82751585 GGGGCGGGGCGGGGGCGGGTGGG - Intergenic
1152870633 17:82751574-82751596 GGGGCGGGGCGGGGGCGGGGCGG - Intergenic
1152922389 17:83072570-83072592 GGTGTGGGGCGGGGGCGGAGGGG + Intergenic
1152924035 17:83079523-83079545 GGGCGGGGTCGGGGGCGGGGCGG + Intergenic
1152924094 17:83079728-83079750 CGAGCCGGGCGGGGGCGGGGCGG - Exonic
1153219387 18:2847969-2847991 GGGCCGGGGCGGTGGGGGTGGGG + Intronic
1153779308 18:8479973-8479995 GGACCGGGGTGGGAGTGGGGGGG - Intergenic
1153855130 18:9137300-9137322 GGGGCGGGGCGGGGGCCGGGCGG + Intronic
1153872605 18:9334686-9334708 GGACCCCAGCGGGGGCGGAGGGG + Intergenic
1154202335 18:12308187-12308209 GGGCGGGGGCGGGGGCGCGGAGG + Exonic
1154452592 18:14489428-14489450 GGTCCTGGCCCGGGGCGGAGGGG + Intergenic
1154966531 18:21363269-21363291 GGGGCGGGGGGGAGGCGGAGTGG - Intronic
1156448589 18:37254046-37254068 GGCCGGGGGCGGGGCCCGAGGGG - Intronic
1156726200 18:40130460-40130482 GTACCTGGGTTGGGGCGGAGGGG + Intergenic
1157261005 18:46175113-46175135 GGACGGGGGTCGGGGCGGGGGGG - Intronic
1157496666 18:48161717-48161739 GGAGCGGGGCGGGGCTGGGGCGG - Intronic
1158435890 18:57435525-57435547 GGGGCGGGGTGGGGGCGGACGGG - Intergenic
1158435898 18:57435536-57435558 CGCCCGGGGTGGGGGCGGGGTGG - Intergenic
1158436001 18:57435842-57435864 GGGCGGCGGCGGGGGCGGCGGGG + Exonic
1158541167 18:58355958-58355980 GGACCGGGGCGGGGGAGTGCAGG - Intronic
1158893503 18:61893971-61893993 GGACCGCGGAGGGGGTGGCGGGG - Intronic
1159008591 18:63037202-63037224 TCACCGGGGCGGGGGCGGGGTGG - Intergenic
1159670149 18:71212524-71212546 GGCGGGGGGCGGGGGCGGCGGGG + Intergenic
1159914144 18:74173598-74173620 GGTGCGGGGCGGGGGTGGTGAGG + Intergenic
1160157005 18:76441930-76441952 CGGCCGAGGAGGGGGCGGAGGGG - Exonic
1160452424 18:78974404-78974426 GGACTGGCGCGGGGGGGGCGGGG + Intergenic
1160454841 18:78992948-78992970 GCGCCGGGGCGGGGGCAGCGGGG - Exonic
1160499211 18:79394183-79394205 GGACCGCGGCTGGGGTCGAGGGG + Intergenic
1160592186 18:79951139-79951161 GGCCCGGGGCGCGCGAGGAGCGG + Intronic
1160594508 18:79964580-79964602 GGGCGGAGGCGGGGCCGGAGCGG - Exonic
1160668422 19:344488-344510 GGGCCGGGGTGGGGGAGGGGAGG - Intronic
1160675861 19:390940-390962 GGGCCGGGGCGGGGGCCGGGGGG - Intergenic
1160691444 19:462062-462084 GGGCCGGGGAGGTGGGGGAGGGG + Intergenic
1160719207 19:590097-590119 GGCCCGGGGCGGGTGCTGGGGGG - Exonic
1160775190 19:852279-852301 GGAGCCGGGCGGGCACGGAGGGG + Exonic
1160776808 19:860435-860457 GCGCGGGGGCGGGGGGGGAGGGG - Intronic
1160840735 19:1146058-1146080 AGGCCGGGGCTGGGGCGGTGTGG - Intronic
1160859005 19:1229827-1229849 GGGCCGCGGCGCGGGCGGGGAGG + Exonic
1160861892 19:1240760-1240782 GAACCCGGGCGGGGGGGGGGGGG - Intergenic
1160864105 19:1249608-1249630 GGGCGGGGGCGGGCGCGGAGAGG + Intronic
1160868266 19:1265703-1265725 GGCCCGGGGGTGGGGCGGGGTGG + Intronic
1160892764 19:1387902-1387924 CGAACGGGGCGGGGGGGGTGGGG + Intronic
1160935424 19:1592437-1592459 GGCCCGGGGCAGGGGCGCCGAGG + Intronic
1160994750 19:1877474-1877496 GGGCGGGGACGGGGGCGGGGCGG - Intronic
1161072804 19:2270883-2270905 GGCCTGGAGCGGGGGCGGGGGGG + Intronic
1161094443 19:2381572-2381594 GGAGCGAGGCAGGGGCGGTGGGG - Intergenic
1161210443 19:3062653-3062675 TGCCCGGGGCGGGGGCGGGCCGG - Intronic
1161215815 19:3094589-3094611 GGGCCGGGCCGGGGGCCGGGGGG + Exonic
1161216195 19:3096017-3096039 GGGCCGGGGGCGGGGCGGTGGGG + Intronic
1161301549 19:3545193-3545215 GGACCGGGGCGGGTGCAGGCGGG - Intronic
1161333751 19:3700205-3700227 GGGCCGGGGCGGGGGCTGCACGG - Intronic
1161335126 19:3708829-3708851 GGACCGGGGAGGCGGCAAAGGGG + Intronic
1161337565 19:3722566-3722588 GCGCCGTGGCGGGGGCGGGGCGG + Intronic
1161403278 19:4078260-4078282 TGGCCGGGGCGGGGGGGGGGGGG + Intergenic
1161505077 19:4639504-4639526 GGGCCGGGGCCGGGGCGGGGCGG - Intronic
1161569614 19:5023395-5023417 TGCCCGGGGCTGGGGCCGAGTGG + Intronic
1161682446 19:5686997-5687019 GGGCCGGGGCCGCGGAGGAGCGG - Intronic
1161779313 19:6280222-6280244 GGAGGGGGGCGGGGGCGGGACGG + Intergenic
1161810784 19:6470056-6470078 GGGCCGTGGGCGGGGCGGAGGGG + Intronic
1161849253 19:6730452-6730474 GGAGTGGGGCGGGGCCTGAGTGG - Intronic
1161853557 19:6751335-6751357 GGACTGGGTTGGGGGTGGAGGGG - Exonic
1161976534 19:7610814-7610836 GGGCCGGGTCGGGGGCGGGTGGG + Intronic
1161977191 19:7613197-7613219 GGCCTGGGGCGGGGGCGGGTGGG + Intronic
1162033154 19:7925929-7925951 GGGCGGGGGCGGTGGGGGAGGGG - Intronic
1162033159 19:7925935-7925957 GCGCCGGGGCGGGGGCGGTGGGG - Intronic
1162367749 19:10259591-10259613 GGGGCGGGGTGGGGGCGGGGCGG - Intronic
1162471020 19:10871974-10871996 GGCCCGGGGCGGGGGCCGGCGGG + Intronic
1162481282 19:10928470-10928492 GGACCGGCTCGGGGGCGGGGGGG - Intronic
1162525370 19:11203448-11203470 GGAGGGGGGCGGGGGCGAAGAGG + Intronic
1162535771 19:11262276-11262298 GGACCCGGGCCGAGGCGGAAAGG + Intronic
1162535864 19:11262515-11262537 GGGGCGGGGCGGGGCCGGCGCGG + Intergenic
1162562623 19:11426338-11426360 AGATGGGGGCGGGGGCGTAGGGG + Intronic
1162566118 19:11446592-11446614 GGACAGGGGTGGGGGAGGAAGGG - Intronic
1162573138 19:11483878-11483900 GGGACGGGGCGGGGTCAGAGTGG + Intronic
1162778757 19:12995918-12995940 GGCCGGCGGCGCGGGCGGAGGGG + Intronic
1163117590 19:15197736-15197758 GGGCTGGGGCGGGGGGGGGGGGG - Intronic
1163117968 19:15199914-15199936 GGGCCGGGGAGGGGGCTGCGGGG - Intronic
1163123749 19:15233138-15233160 AGGCCGGGGAGGGGGCGGTGGGG + Intronic
1163304839 19:16471653-16471675 GGTCCGGGCCCTGGGCGGAGAGG + Intronic
1163427073 19:17245676-17245698 CGCCCGTGGCGGGGGGGGAGGGG + Exonic
1163437325 19:17303258-17303280 GGGCCCGGGTCGGGGCGGAGGGG + Exonic
1163466473 19:17470856-17470878 GGGCGGGGGCGGGGCCTGAGAGG + Intronic
1163485177 19:17581158-17581180 GGACCTGGGGGGAGGAGGAGGGG - Exonic
1163492210 19:17623563-17623585 GGGGCGGGGCGGTGGGGGAGGGG + Intronic
1163591168 19:18194901-18194923 AGAGCTGGGCGGGGGCGGAGCGG - Intronic
1163597077 19:18226385-18226407 GGACCGGGGCGGGCGCGGGGGGG + Intronic
1163601446 19:18251680-18251702 GGGCGGGGGCGGGGGCGGGGGGG - Intronic
1163623217 19:18373000-18373022 GCACCCAGGCGAGGGCGGAGGGG - Intergenic
1163623524 19:18374644-18374666 GCACGGGGGTGGGGGCGGGGGGG + Intergenic
1163635138 19:18434019-18434041 GTCCCGGGGTGGGGGCGGATGGG - Intronic
1163674146 19:18646953-18646975 GGGCGGGGGCAGGGGCGGCGGGG + Intronic
1163674793 19:18650180-18650202 GGACCCGGGCGGGAGCGGTCTGG + Intronic
1163698337 19:18775118-18775140 GGGACGGGGCGGGGGCCGAGGGG - Intronic
1163727750 19:18932290-18932312 GGGGCGGGGCAGGGGTGGAGTGG + Intronic
1163758506 19:19120667-19120689 GGACCGCGGTGGGGGGGGAGAGG - Intronic
1163783413 19:19261942-19261964 GGGCCGGGGCGGGCAGGGAGGGG + Intronic
1164274218 19:23702649-23702671 GGGCGGGGGCGGGGGCGGGGGGG - Intergenic
1164594771 19:29525868-29525890 GCTCTGGGGCGGGGGCGGGGCGG + Intergenic
1164648102 19:29873619-29873641 GGCGCGGGGCCGGGTCGGAGCGG - Intergenic
1164648253 19:29874215-29874237 GGCTCGGGGCGAGGGGGGAGGGG + Intergenic
1164676275 19:30103881-30103903 GGAGAGGGGCTGGAGCGGAGAGG - Intergenic
1164693570 19:30227654-30227676 GGGCCGGGGCGAGGGGCGAGCGG + Intergenic
1164834785 19:31349964-31349986 CGCACGGGGCGGAGGCGGAGGGG - Intergenic
1165305527 19:35000558-35000580 GGCTTGGGGAGGGGGCGGAGCGG + Intronic
1165349689 19:35269074-35269096 GGGCGGGGGCGGGGGGGGCGCGG - Exonic
1165349735 19:35269187-35269209 GGGCCGGGGCCGGGGCGCGGGGG - Intronic
1165459510 19:35936455-35936477 GGGCCGAGGCGGGGGCCGGGCGG - Intronic
1165578004 19:36838274-36838296 GGCCCGAGGCCGGGGCTGAGGGG - Intronic
1165737026 19:38183351-38183373 GGAGCAGGGTGGGGGCGGAGAGG + Intronic
1165772484 19:38387361-38387383 GAACAGGGGCGGGGCCGGTGCGG - Intronic
1165851438 19:38852190-38852212 GCAGCGGGGTGGGGGCGGGGCGG - Intronic
1165939159 19:39406760-39406782 GGCCGGGGGCGGGGCAGGAGGGG - Intergenic
1166039189 19:40191803-40191825 GGGGCGGGGCGGGGTGGGAGTGG - Exonic
1166367467 19:42284629-42284651 GGAGCGGGCTGCGGGCGGAGCGG + Intronic
1166384140 19:42370839-42370861 GAACCGGGGGGGGGGGGGGGGGG + Intronic
1166514932 19:43439434-43439456 GGGCCGGGGTGGAGGCGGCGGGG - Intergenic
1166524966 19:43504909-43504931 GGGCCGGGCCGGGGCCGGTGGGG - Exonic
1166547052 19:43639904-43639926 AGGCCGGGGCGGGGCCGGGGAGG + Intergenic
1166789762 19:45391913-45391935 GGACGGGGCCGGGGGTGGAATGG + Exonic
1166843414 19:45712422-45712444 GTCCCGGGCAGGGGGCGGAGGGG + Exonic
1166869827 19:45864418-45864440 GGGCCGGAGCGGGGGCGGGTGGG + Exonic
1167050044 19:47072492-47072514 GGGCCCGGGCGGTGGGGGAGGGG + Exonic
1167158725 19:47754649-47754671 GGCCCGGGGAGGGGAGGGAGTGG - Intronic
1167258164 19:48443198-48443220 GGCGCGGCACGGGGGCGGAGCGG - Exonic
1167368089 19:49065076-49065098 GGTCGGGGGCGGGGGCGGGGCGG + Intronic
1167379036 19:49128123-49128145 GGACAGGGGCGGGGCATGAGGGG + Intronic
1167454528 19:49591459-49591481 GGGAGGGGGCAGGGGCGGAGGGG - Intergenic
1167482265 19:49740219-49740241 GGACTGGGCTGGGGGTGGAGGGG + Intronic
1167600366 19:50451353-50451375 GGACCGGGCTGAGGGAGGAGGGG + Intronic
1167622119 19:50566369-50566391 GGGGCGGGGAGGGGGCCGAGGGG + Intronic
1167649006 19:50719530-50719552 GGCCCGGGGAGGGGGCGGGCGGG + Intergenic
1167765591 19:51480141-51480163 GGACCACGGCAGGGGCTGAGGGG + Intronic
1167862488 19:52297043-52297065 GGGGCGGGGGCGGGGCGGAGTGG - Intergenic
1167862489 19:52297048-52297070 GGGCGGGGGCGGGGGCGGGGCGG - Intergenic
1167889345 19:52527515-52527537 GGGCCGGGGCGGGGCCGGGGCGG - Intergenic
1167940566 19:52942715-52942737 GGGCGGGGGCGGGGCCGGGGCGG + Intronic
1167972436 19:53197004-53197026 GGCAGGGGGCGGGGCCGGAGGGG - Intergenic
1168056074 19:53866128-53866150 GGAGCAGGGAGGGGCCGGAGGGG - Intergenic
1168056501 19:53867817-53867839 GGACGGGGGCGGGGCCGGGGCGG - Intronic
1168144895 19:54415473-54415495 CGAGCGGGGCGCGGGCGGCGCGG - Intronic
1168235949 19:55063186-55063208 GGGGCGGGGCGCGGGCGGAGGGG + Intronic
1168258485 19:55179912-55179934 GGAGTGGGGCGCAGGCGGAGGGG - Intronic
1168314113 19:55476687-55476709 GGACCGGGGAGGGGGGGCAGGGG - Exonic
1168315198 19:55482002-55482024 GGGCGGGGGCGGGGGCGGCGGGG - Exonic
1168344410 19:55643420-55643442 GGTCGGGGGCGTGGGCGGAAGGG - Exonic
1168350882 19:55674955-55674977 GGGCCGGGGCGGGCGTGGCGTGG + Intergenic
1168679936 19:58307608-58307630 GGAGCGGGGCGGGGAGGGGGGGG - Intronic
1168713905 19:58516370-58516392 GAGCCAGGGCGGGGGAGGAGAGG - Intronic
1168714125 19:58517263-58517285 GGGCAGGGGCGTGGGCGCAGAGG + Exonic
925257503 2:2502803-2502825 GGACTGGGGTGGGGGTGCAGAGG - Intergenic
925610018 2:5694447-5694469 GGGGCGGGGCGGGGGAGGGGAGG + Exonic
925959852 2:9004048-9004070 GGACCCGGGCGAGGGCGCCGAGG + Intergenic
926422928 2:12716829-12716851 GGGCCCGGGCGGGGGCGGGGCGG + Intergenic
926581494 2:14635151-14635173 GGAACGGGGAAGGGGCTGAGGGG + Exonic
927153032 2:20206365-20206387 GACCGGGGGCGGGGGCGGGGAGG + Intronic
927156223 2:20223404-20223426 GGGAAGGGGCGGGGGCGGGGTGG - Intronic
927215325 2:20665396-20665418 AGACCGGGGGGCTGGCGGAGTGG + Intergenic
927501234 2:23584629-23584651 GCACAGAGGCTGGGGCGGAGGGG + Intronic
927508010 2:23627043-23627065 GGAGCGGTGCTGGGGAGGAGCGG - Intronic
927658441 2:24971698-24971720 GGGCCTGCTCGGGGGCGGAGAGG + Intronic
927708438 2:25311119-25311141 GGCTGGGGGCGGGGGCGGGGAGG + Intronic
927714081 2:25341528-25341550 GGAGCCGGGCGGGGGCGGGGAGG + Intronic
927714336 2:25342245-25342267 GGACCCCGGCGGGGCCGCAGAGG - Intronic
927964757 2:27262190-27262212 AGACGGGGCCGGGGGCGGCGAGG - Intronic
928042357 2:27890849-27890871 GGACTGGGGCTGGTGCGGGGAGG + Exonic
928308640 2:30191893-30191915 TGACAGGGGCTGGGGCGGAGAGG + Intergenic
928602776 2:32916572-32916594 GGGGGGGGGCGGGGGCGGGGGGG + Intergenic
928602780 2:32916578-32916600 GGGCGGGGGCGGGGGGGGGGAGG + Intergenic
928928072 2:36598190-36598212 GGGCCGGGGCGGGGCCGGGCTGG - Exonic
929242311 2:39665760-39665782 GGGCCGGGCCGGGGGCGGGCGGG + Intronic
929966913 2:46542993-46543015 GGGCCGGGGCGGGGGCTCCGGGG + Exonic
930071329 2:47369087-47369109 GCACCTGGGGCGGGGCGGAGCGG + Intronic
930610727 2:53539925-53539947 GTACTGGGGTGGGGGGGGAGGGG + Intronic
931671761 2:64653990-64654012 GGGCCGGGGCGGGGCCGGCGGGG - Intronic
931728174 2:65130483-65130505 CCACGGGGGAGGGGGCGGAGAGG + Intergenic
931762591 2:65431260-65431282 GGACCGAGGCGTGTGCGGCGGGG - Intronic
931825523 2:65996625-65996647 AGACGGGGGCGGGGGCGGGGTGG - Intergenic
932314176 2:70768442-70768464 GGTGCGGGGCGGGGGTGGAAGGG - Intergenic
932316936 2:70790694-70790716 AGGCCCGGGCGGGGGCGGGGCGG + Intergenic
932496025 2:72146155-72146177 GGACCTGAGGGGGGGCAGAGAGG + Intronic
932496426 2:72147901-72147923 GGACCGGAGCGGCGGGGGAGGGG + Exonic
933666808 2:84971102-84971124 GGGCCGGGGGAGGGGAGGAGCGG + Exonic
933700683 2:85253356-85253378 TCACAGGGGCGGGGGCGGGGAGG + Intronic
933847470 2:86337425-86337447 GGCCGGGGGCGGGGAGGGAGGGG + Intronic
934296816 2:91749019-91749041 GGGCCGCGGCGGCGGCGGCGAGG - Intergenic
934525553 2:95049491-95049513 GGCAAGGGGCGGGGGTGGAGGGG + Intronic
934538832 2:95158737-95158759 TGACCGTGGCGGAGGTGGAGGGG - Intronic
934618522 2:95790070-95790092 GGCCCTGGGCGGGGGCTGTGGGG + Intergenic
934642371 2:96034489-96034511 GGCCCTGGGCGGGGGCTGTGGGG - Intronic
934763920 2:96870003-96870025 GGAGCCGGGCGGGGACGGAGGGG - Intronic
935237588 2:101151447-101151469 GGCCAGGGGCGGGTGCGGGGCGG - Intronic
935237600 2:101151470-101151492 GGCCAGGGGCGGGTGCGGGGCGG - Intronic
935592481 2:104855374-104855396 GGGCGGGGGCGGGGAAGGAGGGG + Intergenic
935669746 2:105544879-105544901 GGACCGGGGCTGGCATGGAGTGG + Intergenic
935673969 2:105578490-105578512 GCACCTGGGCTGGGGCAGAGAGG - Intergenic
936064203 2:109318319-109318341 GGACCGGGCTGGGGGCCGGGAGG - Intronic
936217998 2:110576897-110576919 CGACCCGGCCGGGGGGGGAGGGG - Intronic
936234610 2:110732485-110732507 GGGCCGGGGAGGGAGGGGAGAGG + Intergenic
936280078 2:111131217-111131239 GGATGGGGGCGGGGGTGGGGGGG + Intronic
937112706 2:119378721-119378743 GGATCGGGGCGGGGGGGCCGGGG + Intergenic
937132609 2:119524479-119524501 GGACTGGCGCGGGGTCGGCGCGG + Exonic
937221750 2:120346076-120346098 GGGCGCGGGCGGGGGCGGGGCGG + Intergenic
937932884 2:127219712-127219734 GGAGCGGGGCGGGGGCGTTGGGG - Intronic
938018198 2:127885402-127885424 GGGCGGGGGAGGGGGCGGCGGGG + Intronic
938073182 2:128318905-128318927 GGACCGGGGCGGGGCGGCGGCGG - Intergenic
938075147 2:128327896-128327918 GGGCCTGGGCTGGGGCAGAGTGG + Intergenic
938301050 2:130213522-130213544 GGACCGGGGCGGGGGCTCCGGGG - Intergenic
938455670 2:131460945-131460967 GGGCCGGGGCGGGGGCTCCGGGG + Intergenic
938460233 2:131492096-131492118 GGACGGGGGCGGGGGCAGCGGGG + Intronic
938644753 2:133319144-133319166 GGAAGGGGGCGGGGGGGGAGGGG - Intronic
939700622 2:145386640-145386662 GGATGGGGGCGGGGGCAGGGGGG - Intergenic
939914264 2:148020763-148020785 GGAGAGGGGCGGGGTGGGAGAGG - Intronic
939914299 2:148020899-148020921 GTACAGGAGCGGGGGCGGGGAGG - Intronic
940145646 2:150542444-150542466 GGACGGTGGGGGGGGCGGGGAGG + Intergenic
940872329 2:158870340-158870362 GGTCAGGGGAGGGGGGGGAGAGG - Intergenic
940962235 2:159798242-159798264 GGAGCGGGGCGGGGCGGGAGCGG + Exonic
941385119 2:164842075-164842097 GGAACGGGGCGGGGGTGGGCCGG + Intronic
941951305 2:171160199-171160221 GCCCCGGGGCGGGGGGGGCGGGG + Intronic
942342493 2:174962659-174962681 GGCCCGGGGGGGGGGGGGGGGGG + Intronic
943767526 2:191678520-191678542 GGACAGGGGCGAAGGCAGAGGGG - Exonic
944111434 2:196135488-196135510 GCTCCTGGGCGGGGGCGCAGTGG + Exonic
944221716 2:197310381-197310403 GGCCCAGGGCGGGGACGGCGCGG + Intronic
944413358 2:199462658-199462680 GGGTCTGGGCGGGGGCGGAGAGG + Intronic
944676015 2:202034508-202034530 GGGCCGGGCCGTGGGCGGCGTGG - Intergenic
945251679 2:207769902-207769924 TGACCCGGGCGGGGCGGGAGAGG - Intergenic
946301664 2:218827950-218827972 CCAGAGGGGCGGGGGCGGAGGGG - Intronic
947119425 2:226799863-226799885 GGAGAGGGGCGGGCGCGGGGCGG - Intergenic
947257739 2:228183717-228183739 GGGGCGGGGCGGGGGGGGGGGGG - Intergenic
947418469 2:229921677-229921699 GGACCGGGCCGGGGGTGGACGGG - Intronic
947593373 2:231396879-231396901 GGACCGGGGTTGGGGTGGGGGGG + Intronic
947745053 2:232503169-232503191 GGAGCGCGGCGGGGGCGGTGAGG - Intergenic
947782129 2:232777605-232777627 GGGGCGGGGGGGGGACGGAGAGG - Intronic
947860469 2:233354426-233354448 GGGCCGGGCCGGGGGCGGTGGGG - Intergenic
947992274 2:234497110-234497132 GGTCCGGGGCGGGGCGCGAGGGG - Intergenic
948046854 2:234951937-234951959 GGGCGGGGGCGGGGGCGCGGGGG - Intergenic
948116036 2:235494633-235494655 GGCGCGGGGCGGCGGCGGCGGGG + Exonic
948192498 2:236070764-236070786 GGGCCGGGGCAGGGGCGGGGAGG + Intronic
948393338 2:237627571-237627593 GGGCCGGGGCCGGGCCGGGGCGG + Intronic
948438128 2:237967396-237967418 TGACCGCGGCGGCGGCGGCGGGG + Intronic
948806006 2:240453637-240453659 GGAAGGGGGCGGGCGGGGAGAGG - Intronic
948862112 2:240757655-240757677 GGGCCGGGGCCGGGGCTGGGGGG + Intronic
948911105 2:241003109-241003131 GGGCCCGGGGGAGGGCGGAGGGG - Intronic
948945680 2:241217929-241217951 GCGCAGGGGCGGGGGCGGGGGGG + Intronic
948945782 2:241218141-241218163 GGGGCGGGGCGGGGGGGCAGCGG + Intronic
948991742 2:241559095-241559117 GGCCCCGGGCCGGGGCGGGGAGG + Intronic
949004330 2:241636902-241636924 GGGTCGGGGCGGGGGCGTGGCGG + Intronic
1168769790 20:408009-408031 GGCCGGGGGCGGGGCCGGGGGGG - Intronic
1168804449 20:664213-664235 GCGGCGGGGCGGGGGCGGCGGGG - Exonic
1168833134 20:858313-858335 GGACTGGGGTGGAGGCGGTGGGG + Intergenic
1169046118 20:2535836-2535858 GGGAGGGGGCGGGGGCTGAGCGG + Intergenic
1169065830 20:2693600-2693622 GGACCGGATCCGGGGCGGCGGGG + Intronic
1169164125 20:3407700-3407722 GGGCGGGGGCGGGGGCGTGGAGG + Intergenic
1169193193 20:3670447-3670469 TGACCTGGGTGGTGGCGGAGTGG - Intronic
1169194077 20:3674048-3674070 GGACCAGGTTGGGGGCGGCGGGG - Exonic
1170149983 20:13219571-13219593 GGAACGGTGCGAGGGAGGAGGGG - Intergenic
1170163956 20:13343575-13343597 GGGCGGGGGCGGGGGCGGCGGGG - Intergenic
1170438102 20:16350720-16350742 GGAGCTGGGTGGGGGCGGGGGGG + Intronic
1170600149 20:17835757-17835779 TGGCCGGGGCGGGGGCGGGAAGG - Intergenic
1171473493 20:25390378-25390400 GGACGGGGGCGGCCGCGGATCGG + Intronic
1171780074 20:29410304-29410326 GGGACGGGGCGGGGGCAGGGCGG - Intergenic
1171868201 20:30505975-30505997 GGTGCGGGGTGGGGACGGAGGGG - Intergenic
1171897023 20:30816569-30816591 GGACTGGAGCGTGGGCGGAAGGG - Intergenic
1172011039 20:31845697-31845719 GGAGTGGGGCGAGGGAGGAGGGG - Intergenic
1172037003 20:32018176-32018198 GGGCGGGGGCGGGGGAGGGGCGG + Intronic
1172037018 20:32018199-32018221 GGGCGGGGGCGGGGGAGGGGCGG + Intronic
1172100935 20:32483645-32483667 GGCACGGGGCGGGGGCGGGGGGG + Intronic
1172109407 20:32536484-32536506 GGGCAGGGGCGGGGGCGAGGCGG + Intronic
1172360785 20:34311517-34311539 GGGGCGGAGAGGGGGCGGAGAGG + Intronic
1172422032 20:34825657-34825679 GGACCGGGCCGGGGAGGGAGGGG + Intergenic
1172773129 20:37393027-37393049 GGGCCTGGGCGGGAGCGGGGAGG - Intronic
1172993442 20:39052408-39052430 GGGCAGGGGCAGGGGCGGGGGGG + Intergenic
1173213232 20:41054295-41054317 GGGCAGGTGCGGGGGCGGGGTGG - Intronic
1173454100 20:43189782-43189804 GGACTGGGGCGGGCGCGGGGTGG + Exonic
1173576641 20:44116294-44116316 CGACCGGGGCGCCGGCGCAGCGG - Exonic
1173617263 20:44411277-44411299 CGACCTGGGCAGAGGCGGAGAGG - Intronic
1173664449 20:44754613-44754635 GGAAGGGGGCGGAGGAGGAGGGG + Intronic
1173916078 20:46709619-46709641 GGACAGAGGCGGGGGCGGGCCGG + Exonic
1174133222 20:48360181-48360203 GGGCGGGGGCGGGGGCGGGAGGG + Intergenic
1174246855 20:49188150-49188172 GGTCCTGGGCGGTGGCGGCGAGG + Exonic
1174284011 20:49459549-49459571 GGACAGGGGAGGGGGTGTAGTGG + Intronic
1174385639 20:50187211-50187233 GGAGCCAGGCGGGGGCGGGGAGG - Intergenic
1174804655 20:53594379-53594401 GGGGCGGGGCCGGGGCGGTGTGG - Intronic
1175203954 20:57296945-57296967 GGACGGGGGCAGGGTGGGAGGGG + Intergenic
1175210470 20:57350903-57350925 GGACGGGGGCGGGGGGCGGGGGG + Intergenic
1175521343 20:59604381-59604403 GCGCCGGGGTGGGGGAGGAGGGG - Intronic
1175715820 20:61253407-61253429 GCCCCTGGGCGGAGGCGGAGGGG + Intronic
1175765250 20:61587879-61587901 GGGCCTGGGCGGGGGCGGAGTGG - Intronic
1175847479 20:62066132-62066154 GCGCCGGGGCGGTGGCGGACGGG + Intergenic
1175847509 20:62066204-62066226 GGGCCGAGGCGGGCGCGGGGCGG + Intergenic
1175873833 20:62220353-62220375 CGGGCGGGGCGGGGGCGGGGAGG - Intergenic
1175992547 20:62796833-62796855 GGTCCGGGGCGGGGTCCGAAGGG - Intronic
1176005572 20:62860943-62860965 GGGCCGGGGCGGAGGCAAAGGGG - Intronic
1176098001 20:63353085-63353107 GGACTGGGGTCGGGGTGGAGGGG - Intronic
1176128960 20:63488210-63488232 CGCGCGGGGCGGGGGCGGGGCGG + Exonic
1176131781 20:63499348-63499370 GGACCGGGACGGAGACGGCGCGG + Intergenic
1176148014 20:63574076-63574098 TGGCGGGGCCGGGGGCGGAGGGG - Intronic
1176159693 20:63641921-63641943 GGGCCGGGGCGGGGCCGGGGCGG - Intronic
1176221154 20:63969850-63969872 GGGCCGGGGCGGGGGGCGCGGGG + Intronic
1176241968 20:64079523-64079545 GGGTGGGGGCGGGGGCGGACAGG + Intronic
1176286699 21:5022469-5022491 GGGGCGGGGCGGGGACGGGGCGG + Intergenic
1176301593 21:5101435-5101457 GGACAGGGGCAGGGACGGGGCGG + Intergenic
1176547848 21:8209135-8209157 GGACCGGTGCGCGGGCGCTGCGG + Intergenic
1176551861 21:8226581-8226603 GGTGCGGGGTGGGGACGGAGGGG + Intergenic
1176555739 21:8253337-8253359 GGACCGGTGCGCGGGCGCTGCGG + Intergenic
1176566786 21:8392170-8392192 GGACCGGTGCGCGGGCGCTGCGG + Intergenic
1176568294 21:8397714-8397736 GGGCCGGGGCGGAGACGGGGAGG - Intergenic
1176569393 21:8401801-8401823 GAAACGGGGCGCGGCCGGAGAGG + Intergenic
1176570770 21:8409580-8409602 GGTGCGGGGTGGGGACGGAGGGG + Intergenic
1176574676 21:8436371-8436393 GGACCGGTGCGCGGGCGCTGCGG + Intergenic
1176578679 21:8453727-8453749 GGTGCGGGGTGGGGACGGAGGGG + Intergenic
1176611290 21:8987664-8987686 GGACCGGTGCGCGGGCGCTGCGG + Intergenic
1176630100 21:9129526-9129548 GGACCCTGGCGGGGGCTGGGAGG - Intergenic
1176643177 21:9325235-9325257 GGACCCTGGCGGGGGCTGGGAGG + Intergenic
1178481496 21:32983174-32983196 GGGCAGGGGAGGGGGAGGAGAGG - Intergenic
1178493996 21:33071502-33071524 GAGCAGTGGCGGGGGCGGAGGGG + Exonic
1178525458 21:33324868-33324890 GGAACGGCGCGTGCGCGGAGGGG + Intronic
1178610200 21:34073393-34073415 GGGTCGGGGCGGGGGCGGTGCGG + Intronic
1178888035 21:36497724-36497746 GGACCTGGGCGGGGGCAGAAGGG - Intronic
1179128311 21:38611797-38611819 GGACAGGGGTGGGCACGGAGTGG + Intronic
1179358364 21:40682744-40682766 GGAGCGGAGGGGGGGGGGAGGGG + Intronic
1179792971 21:43766103-43766125 GGGCGGGGGCCGGGGGGGAGAGG + Intergenic
1179810017 21:43864773-43864795 GGACCGGGTCGGGGGCAGAGGGG - Intergenic
1179855438 21:44160464-44160486 GGACAGGGGCAGGGACGGGGCGG - Intergenic
1179870482 21:44241006-44241028 GGGGCGGGGCGGGGACGGGGCGG - Intergenic
1179891666 21:44338754-44338776 GGGGCGGGGCGGGGGCGGAGTGG - Intronic
1180064307 21:45405083-45405105 GGGCCGGGCAGGGGGCGGGGCGG - Intergenic
1180101826 21:45590990-45591012 GGGCGGGGGCGGGGGCGGCAGGG + Intergenic
1180156649 21:45981590-45981612 GGGGCGGGGCGGGAGGGGAGGGG - Intergenic
1180294516 22:10872938-10872960 GGAACGGGGTGGGTGCCGAGGGG - Intergenic
1180376480 22:12098124-12098146 GGACCCTGGCGGGGGCTGGGAGG + Intergenic
1180497322 22:15902352-15902374 GGAACGGGGTGGGTGCCGAGGGG - Intergenic
1180650004 22:17369668-17369690 GGTCCTCGGCGGGGGCGGCGGGG - Exonic
1180762266 22:18219839-18219861 GGTGCGGGGAGGGGGCGCAGGGG - Intergenic
1180773401 22:18404769-18404791 GGTGCGGGGAGGGGGCGCAGGGG + Intergenic
1180783942 22:18536613-18536635 GGACCAGGGTGGAGGCGGAGGGG - Intergenic
1180804752 22:18654318-18654340 GGTGCGGGGAGGGGGCGCAGGGG + Intergenic
1180805992 22:18715092-18715114 GGTGCGGGGAGGGGGCGCAGGGG - Intergenic
1180843599 22:18970355-18970377 GGGCCTGGGCGGGGGCTGGGGGG - Intergenic
1180843671 22:18970521-18970543 GGGCCGGGGCTGGGCCGGAGCGG + Intergenic
1180949329 22:19714234-19714256 GCACCGGGGAGGTGGCGGGGAGG + Intergenic
1181057805 22:20268183-20268205 GGGCCGGGGCCGGGCCGTAGCGG - Exonic
1181067355 22:20313219-20313241 TGGCCTGGGCGGGGGCGGGGGGG - Intergenic
1181127509 22:20710662-20710684 GGGCCAGGGTGGAGGCGGAGGGG - Intronic
1181164498 22:20976146-20976168 GGACCGGGGAGTGGGCGGCGAGG + Intronic
1181192497 22:21151702-21151724 GGTGCGGGGAGGGGGCGCAGGGG + Intergenic
1181216942 22:21340873-21340895 GGTGCGGGGAGGGGGCGCAGGGG - Intergenic
1181240841 22:21475965-21475987 GGGCCAGGGTGGAGGCGGAGGGG - Intergenic
1181443316 22:22949806-22949828 GGGCCAGGGCAGGGGCAGAGGGG - Intergenic
1181470746 22:23137787-23137809 GGACGGGGGCTGGTGGGGAGAGG + Intronic
1181491386 22:23262717-23262739 GGGTGAGGGCGGGGGCGGAGAGG + Intronic
1181516316 22:23415592-23415614 GGTGCTGGGCTGGGGCGGAGGGG - Intergenic
1181631890 22:24155964-24155986 GGGCCGGGGCGGGGCAGGCGCGG - Intronic
1181670544 22:24423837-24423859 GGGGCGGGGCGGGGGCAGCGCGG + Intronic
1181768920 22:25111756-25111778 GGATGGGGGTGGGGGTGGAGGGG - Intronic
1182299992 22:29331882-29331904 GGACCTGGAGGGGGGCGGCGGGG + Exonic
1182366393 22:29782247-29782269 GGACCGGGCTGGGAGAGGAGTGG - Intergenic
1182555187 22:31125333-31125355 GCACCGGGGAAGGGGTGGAGGGG - Exonic
1182567482 22:31211101-31211123 GGTCAGGGGTGGGGGTGGAGGGG + Intergenic
1183253616 22:36746754-36746776 GGCCTGGGGCGGGGGGTGAGGGG - Intergenic
1183332792 22:37230268-37230290 GGGGCGGGGCTGGGGCGGTGGGG + Intronic
1183351076 22:37335060-37335082 GAACTTGGGCGTGGGCGGAGCGG + Intergenic
1183455782 22:37922349-37922371 GGAGCGGGGCCGGGGCGTGGGGG - Exonic
1183521433 22:38298127-38298149 GGACAGGGGCGGGGACAGAAAGG + Intronic
1183642509 22:39101137-39101159 GGACGGGGGCGGGGATGGGGGGG - Intronic
1183702216 22:39457243-39457265 GGACCGCGGCGGGCGCGCGGGGG - Intergenic
1183739621 22:39662539-39662561 TGGCCGGGGCGTGGCCGGAGCGG + Intronic
1184085938 22:42264268-42264290 GGGGCGGGGCGGGGGCAGGGTGG + Intronic
1184089303 22:42283907-42283929 GAGCCGAGGCGGGGGAGGAGGGG + Intronic
1184106332 22:42369296-42369318 GGACCGGGGCGGGCGGGGCGTGG + Intergenic
1184164739 22:42720690-42720712 AGGCAGGGGCAGGGGCGGAGGGG - Intronic
1184222629 22:43110682-43110704 GGACCCGGGCGGGGCGGGAGGGG + Intergenic
1184248923 22:43249326-43249348 GGACGGGAGCTGGGGTGGAGGGG + Intronic
1184446543 22:44550804-44550826 GGAGCGGAGCTGGGGAGGAGGGG + Intergenic
1184486536 22:44783296-44783318 GGACCGCTGCGGGGGTGGGGAGG - Intronic
1184557445 22:45240938-45240960 GGACCGGGGCCGGGCCGGGCCGG - Intergenic
1184557458 22:45240965-45240987 GGGCCGGGGCGGGGAAGGGGCGG - Intergenic
1184557464 22:45240976-45240998 GGACAGGGGCGGGGCCGGGGCGG - Intergenic
1184766916 22:46576992-46577014 GGGCGGGGGCGGGGCCGGGGTGG + Intronic
1184778515 22:46635186-46635208 GGCCGGGGGCGGGGGCAGGGAGG - Intronic
1184778554 22:46635278-46635300 GGCCGGGGGCGGGGGCAGGGAGG - Intronic
1184778647 22:46635508-46635530 GGCCGGGGGCGGGGGCAGGGAGG - Intronic
1184778666 22:46635554-46635576 GGCCGGGGGCGGGGGCAGGGAGG - Intronic
1184827076 22:46959609-46959631 GGACAGGGGAGGGGACAGAGAGG - Intronic
1185217251 22:49608412-49608434 GGATCTGGGCGGGGGCTGAGAGG - Intronic
1185272497 22:49935613-49935635 GGAGCAGGGTGGGGGCGGAGGGG + Intergenic
1185272516 22:49935654-49935676 GAGCAGGGGCGGGGACGGAGGGG + Intergenic
1185272620 22:49935893-49935915 GAGCAGGGGTGGGGGCGGAGGGG + Intergenic
1185275501 22:49948829-49948851 GGACCTGGGCAGGTGAGGAGAGG - Intergenic
1185314009 22:50170974-50170996 GGCGCGGGGCGCGGGCAGAGGGG + Intronic
1185347566 22:50317104-50317126 GGACAGGGTGGGGGGCGGCGAGG + Intronic
1185397634 22:50600932-50600954 GGGCCGGGTCGGGGTCGGGGGGG - Intronic
1203235231 22_KI270731v1_random:145751-145773 GGTGCGGGGAGGGGGCGCAGGGG + Intergenic
1203252724 22_KI270733v1_random:125422-125444 GGACCGGTGCGCGGGCGCTGCGG + Intergenic
1203256882 22_KI270733v1_random:143503-143525 GGTGCGGGGTGGGGACGGAGGGG + Intergenic
1203260780 22_KI270733v1_random:170508-170530 GGACCGGTGCGCGGGCGCTGCGG + Intergenic
949260726 3:2099750-2099772 GGCCCGGGGAGGGGACGGGGCGG - Intronic
949748361 3:7322556-7322578 GGACTGGGGTGGGGGAAGAGGGG - Intronic
950040176 3:9915136-9915158 GGGCGGGGGCGGGGGCGGAGAGG + Intronic
950400962 3:12768914-12768936 GGGCCGGGGCCGGGGCGGGGCGG + Intronic
950400969 3:12768920-12768942 GGGCCGGGGCGGGGCGGGGGGGG + Intronic
950400973 3:12768925-12768947 GGGGCGGGGCGGGGGGGGCGGGG + Intronic
950650212 3:14402540-14402562 GGCCGGGGGCGGGGCCGGGGCGG - Intergenic
950729889 3:14947931-14947953 GGCTCGGGCCGGCGGCGGAGGGG + Intronic
950773774 3:15332635-15332657 GGGGCGGGACGGGGGCGGAGCGG - Intronic
951434753 3:22648782-22648804 GGACCGGGGTGGGGGTGGAATGG + Intergenic
951543674 3:23806204-23806226 GGGCCGGCGCGGGGGGGGAGCGG + Intronic
951543676 3:23806209-23806231 GGCGCGGGGGGGGAGCGGAGAGG + Intronic
952354403 3:32570876-32570898 GGAGCGGGGCGGGGCCTGCGGGG + Intergenic
952816631 3:37452591-37452613 GGGCCGGGGCGGTGGCCGCGCGG - Intronic
952883461 3:37999141-37999163 CGGGCGGGGCGGGGCCGGAGGGG + Intronic
952970950 3:38649737-38649759 GGTCGGGGGCGGGGTCGGGGCGG + Intergenic
953030634 3:39177708-39177730 GGGGGGGGGAGGGGGCGGAGGGG + Intergenic
953157361 3:40387135-40387157 ATAGCGGGGCGGGGGCGGGGCGG - Exonic
953319746 3:41961553-41961575 GGAGCGGGGGGGGGGGGGGGGGG - Intronic
953909267 3:46883451-46883473 AGGCCGGGGCGTGGGCGGGGCGG + Exonic
953947647 3:47163593-47163615 GGGCCGGGCCGGTGGGGGAGGGG - Intronic
954004017 3:47578314-47578336 GGGCCGGGGCGGGGCCGGGGCGG - Intronic
954004024 3:47578325-47578347 GGCCGGGGGCGGGGCCGGGGCGG - Intronic
954117146 3:48473238-48473260 GGGCGGGGGCCGGGGAGGAGGGG + Intronic
954150714 3:48655848-48655870 GAACCTGGGCGGGGTGGGAGGGG + Exonic
954204932 3:49051577-49051599 GGAGGGGGGGGGGGGCGCAGGGG - Intronic
954249624 3:49357993-49358015 GGAGCGGGGCGGGGCGGGGGCGG - Intronic
954346507 3:50004302-50004324 GGAGAGGGGAGGGGGGGGAGGGG - Intronic
954581796 3:51707002-51707024 GGCCGGGGCCGGGGGCGGGGCGG + Intergenic
954581800 3:51707007-51707029 GGGCCGGGGGCGGGGCGGGGCGG + Intergenic
954615613 3:51967531-51967553 GATCCGGGGAGGGGGCGGGGAGG - Intronic
954635798 3:52070204-52070226 GGACCTGAGCTGGGGTGGAGAGG + Intergenic
954693868 3:52410177-52410199 GGGACGGGACGGGGGCGAAGGGG + Exonic
954693883 3:52410206-52410228 GGGGCGGGACGGGGGCGAAGGGG + Exonic
954873677 3:53786724-53786746 GGGCAGGGGCAGGGGCAGAGTGG - Intronic
955060299 3:55487469-55487491 GGCCCGGGGCGGGGGAAGGGGGG + Exonic
955228438 3:57079309-57079331 GGGCGGGGCCGGGGGCGGGGAGG + Intronic
955770350 3:62378745-62378767 AGACCTGGGCGGGGGCGTAGGGG + Intergenic
955772735 3:62402224-62402246 GAAACGGGGTGGGGGCGGGGGGG + Intronic
955936750 3:64109584-64109606 GGGCAGGGGTGGGGGAGGAGGGG + Intronic
956420439 3:69081413-69081435 GGAGCGTGGTGGGGGCGGTGAGG - Intergenic
957079381 3:75623537-75623559 GCACTGGGGGGGGGGGGGAGCGG - Intergenic
957085026 3:75670197-75670219 GGGGCGGGGCGGGGGCAGGGCGG + Intergenic
957096904 3:75785350-75785372 GGACCCTGGCGGGGGCTGGGAGG - Intronic
957278157 3:78115674-78115696 GGGCAGGGGCGGGGGAGAAGAGG - Intergenic
958431163 3:94043540-94043562 GGAGGGGGGAGGGGGAGGAGGGG - Intronic
958692150 3:97481683-97481705 GGGGCGGGGCCGGGGCGGTGCGG - Intronic
959253039 3:103972520-103972542 GCACTGGGGCAGGGGTGGAGGGG + Intergenic
960674294 3:120179881-120179903 GACCGGGGGCGGGGGCGGGGTGG - Intronic
960955122 3:123026444-123026466 GGTGGGGGGCGGGGGCGGGGAGG + Intronic
961067176 3:123885014-123885036 GGAAAGGGGAGGGGGGGGAGGGG + Intergenic
961359418 3:126357552-126357574 GGGCCGGGGCGGGGCCAGGGCGG - Intergenic
961427307 3:126858292-126858314 TGGCAGGGGCGGGGGCGGGGGGG + Intronic
961509358 3:127391639-127391661 GGACCGGGTCTGGGGCAGGGAGG - Intergenic
961532488 3:127547866-127547888 GGAAGGGGAGGGGGGCGGAGGGG - Intergenic
961665864 3:128492839-128492861 GGGCCGGGCCGGGGGCGGGAAGG + Intronic
961666833 3:128497933-128497955 GGGCCGGGGCAGGGGAGGGGCGG - Intergenic
961827155 3:129605262-129605284 GGGCGGGGGCGGGGGCGGGCGGG - Intronic
961868901 3:129974536-129974558 GGACCGGAGCCGGGGCGCGGAGG - Exonic
962259930 3:133895764-133895786 GGAGAGAGGCGCGGGCGGAGCGG + Exonic
962272339 3:133987136-133987158 GTGGCGGGGCGGGGGCGGGGGGG - Intronic
962738847 3:138348614-138348636 GCGCCGGGGCGGGGACGGACCGG + Intronic
963133095 3:141876478-141876500 GGGGCGGGGCCGGGGCGGGGTGG + Intronic
963827515 3:149970946-149970968 GAGGCGGGGCGGGGGCGGGGAGG + Exonic
964606194 3:158562802-158562824 GGGTCGGGGTGGGGGCGGGGCGG - Intergenic
965590797 3:170358203-170358225 GGCCCGGGGCTGGCGCGGGGAGG + Intronic
965721963 3:171671983-171672005 AGGCCAGGGCGGGGGCGGGGTGG - Intronic
966079226 3:175978596-175978618 GGACCGGCGGTGGGGCGGCGAGG + Intergenic
966168943 3:177055545-177055567 GGGGCGGGGCGGGGGTGGGGGGG + Intronic
966743387 3:183254059-183254081 GGGGCGGGGGCGGGGCGGAGGGG - Intronic
966743390 3:183254064-183254086 GCGGCGGGGCGGGGGCGGGGCGG - Intronic
966886466 3:184380211-184380233 GGGCCGGGCCGGGGGCGGTGCGG - Exonic
966911599 3:184562840-184562862 GGACCGCTGCGGGGGCGGACAGG + Intronic
967087560 3:186108768-186108790 GGACCGGGCCGCGGGGGGAGGGG + Intronic
967184115 3:186930755-186930777 CGACCGGCGTGGGCGCGGAGCGG + Exonic
967207814 3:187139541-187139563 GGGCCTGGGCGGGGCCGGGGCGG - Intronic
967217873 3:187225571-187225593 GGGCTGGGGCGGGGGCTGACAGG - Intronic
967527808 3:190514519-190514541 GTAGCGGGGAGGGGGCGGTGAGG - Intronic
967859714 3:194141650-194141672 GGCCCGGGGCGGGGGAAGCGGGG - Intergenic
967880350 3:194297241-194297263 GGCCCGGGGCTGGAGGGGAGGGG - Intergenic
968051535 3:195658181-195658203 GGACCGGGGCAGGGCAGGCGGGG + Intergenic
968104282 3:195990152-195990174 GGACCGGGGCAGGGCAGGCGGGG - Intergenic
968302582 3:197627742-197627764 GGACCGGGGCAGGGCAGGCGGGG - Intergenic
1202743707 3_GL000221v1_random:79794-79816 GGACCCTGGCGGGGGCTGGGAGG - Intergenic
968405533 4:336847-336869 GGCCTGGGGTGGGGGCGGCGGGG + Intergenic
968484352 4:851772-851794 TGATCGGGGCGCGGGAGGAGCGG - Exonic
968512913 4:1003215-1003237 GGTCCGGGGCGGGGGCTCCGAGG + Intronic
968514267 4:1009806-1009828 GGACAGGGGCGGGGACGGGGAGG - Intergenic
968514288 4:1009851-1009873 GGGCGGGGCCAGGGGCGGAGCGG - Intergenic
968514978 4:1012011-1012033 GGTCCGGGGCGGGGGCGGGGAGG + Intronic
968529443 4:1083007-1083029 AGACGGGGTCGGGGGCGCAGCGG + Intronic
968556561 4:1248867-1248889 GGCCGCGGGCGGGGGCGGGGCGG - Intronic
968603196 4:1520108-1520130 GGCGAGGGGCGGGCGCGGAGTGG + Intergenic
968603497 4:1520975-1520997 CGACCTGGGCGGGGCTGGAGGGG - Intergenic
968653075 4:1767566-1767588 GGTCGGGGGCGGGGCCGGCGGGG + Intergenic
968659486 4:1793221-1793243 GGAGCGGGGCGGGGCCGGGGCGG + Intergenic
968671029 4:1851743-1851765 TGGCCGGGGCAGGGGTGGAGGGG - Intronic
968698086 4:2042356-2042378 GGACCGGCACGCGGGCGGGGGGG - Exonic
968775177 4:2536147-2536169 GGACAGGGGCGCGGGCGAGGCGG + Intronic
968878289 4:3285738-3285760 GGACTGGGGTGGGGGCAGAGGGG - Intergenic
968879484 4:3291985-3292007 GGGCGGTGGCGGGGACGGAGGGG + Intergenic
968965566 4:3767539-3767561 GGAGGGGGGCGCGGGCGGTGCGG + Exonic
968969033 4:3783982-3784004 GCCCCGGGGCGGGGGTGAAGAGG + Intergenic
969053398 4:4387539-4387561 GGGGCGGGGCGGGGGGGAAGTGG - Intronic
969240379 4:5893119-5893141 GCGCCGGGGCGGGGCCGGGGCGG + Intergenic
969240407 4:5893199-5893221 GGATCGCGGCTGGGGCGGGGAGG + Intergenic
969285702 4:6200665-6200687 GGGCGGGGGCGGGGGCGGGGCGG - Intergenic
969344749 4:6563689-6563711 GGCCCGGGGCGGGGGGCGGGGGG + Intergenic
969370329 4:6727663-6727685 GGACAGGAGAGGGGGAGGAGGGG - Intergenic
969873077 4:10116594-10116616 GGACCGGGGCCGGGGCAGCGCGG + Intronic
971327378 4:25655529-25655551 GGACCGAGTCGGGGCGGGAGAGG + Intronic
971402056 4:26285255-26285277 TGGCGGGGGTGGGGGCGGAGGGG - Intronic
971406209 4:26322095-26322117 GGAGGGGGGCGGGGGCCGGGGGG - Intronic
971409956 4:26359695-26359717 GGGCCGGGGCGGGCGTGGCGTGG + Intronic
971633799 4:29031240-29031262 GGAAGGGGGAGGGGGAGGAGGGG - Intergenic
972396613 4:38663974-38663996 GGGGCGGGGCGGAGGCGGCGCGG + Intergenic
972557216 4:40193516-40193538 GGGGCGGGGTGGGGGAGGAGGGG + Intronic
973360649 4:49161492-49161514 GGACCCTGGCGGGGGCTGGGAGG + Intergenic
973717315 4:53690080-53690102 AGACCTGGGTGGGGGCTGAGAGG - Intronic
974015790 4:56647606-56647628 GGGCCGGGGTGTGGGCGGGGGGG + Intergenic
974761744 4:66285389-66285411 CGACAGGGGCGGGGGTGTAGGGG + Intergenic
975118477 4:70704875-70704897 GGGCCTGGGCGGGGGAGCAGAGG - Intronic
975689696 4:76950744-76950766 GCCCCGGGGCCGGGCCGGAGGGG + Intronic
975702104 4:77076110-77076132 GGACCGGGAAGGCGGCGGGGAGG - Intergenic
976830390 4:89308075-89308097 GGACCGGGAAGGCGGGGGAGGGG - Intergenic
977607226 4:98995558-98995580 GGGCGGGGGCGGGGCCGGGGCGG + Intergenic
977810003 4:101347233-101347255 GGCCGGGGGCGAGGGAGGAGAGG + Exonic
977848309 4:101792251-101792273 GGGGCGGGGCGGGGGGGGAGCGG - Intronic
978072585 4:104491454-104491476 GGGCGGGGGCGGCGGCGGGGGGG - Exonic
978127167 4:105147832-105147854 GGCCCGGGGAGGGGGCGGGAGGG + Intronic
978503647 4:109434122-109434144 GGACGGGAGCGGGCGCGGTGCGG + Intronic
978789339 4:112644275-112644297 GGGGTGGGGCGGGGGCGGGGGGG + Intronic
979468565 4:121070486-121070508 GGACCGGGTGGGAGGAGGAGAGG + Intronic
979630753 4:122900050-122900072 GGGCCGGGGGGGGGGTGGCGGGG - Intronic
980130400 4:128811711-128811733 TTCCCGGGGCGGGGGCGCAGCGG - Intronic
980714100 4:136610324-136610346 AGACAGGGGTGGGGGCGGTGGGG - Intergenic
980930204 4:139177232-139177254 GGAGGGGGCCGGGAGCGGAGCGG - Intergenic
981300847 4:143184832-143184854 GGACAGGCGGAGGGGCGGAGGGG + Intergenic
981704653 4:147646653-147646675 GGGCTGGGGAGGGGGGGGAGGGG + Intronic
982042390 4:151409100-151409122 GGGCCGGGGCGGGGCAGGGGCGG - Intergenic
982235746 4:153249614-153249636 GGGCCGGGGCGGGAGCAGGGAGG - Intronic
984923414 4:184785597-184785619 GGGCGGGGGCGGGGGGGGGGGGG + Intronic
985445920 4:190021380-190021402 GGAGCGGGGTTGGGGCGGGGTGG - Intergenic
985448436 4:190041337-190041359 GGCTCGGGGAGGGGGAGGAGCGG - Intergenic
1202758080 4_GL000008v2_random:83557-83579 GGACCCTGGCGGGGGCTGGGAGG + Intergenic
985472277 5:53597-53619 GGAGAAGGGCGGGGGCGGAGGGG + Intergenic
985497603 5:218434-218456 GGACCGGGGCGGGGCAGGCGGGG + Intronic
985588158 5:751415-751437 GGACAGGTGTGGGGGCGGGGAGG + Intronic
985593618 5:777901-777923 AGCCCGGGGCGGGGGAGGGGGGG + Intergenic
985602828 5:843878-843900 GGACAGGTGTGGGGGCGGGGAGG + Intronic
985737719 5:1594357-1594379 GGACCGGGGCGGGGCAGGCGGGG - Intergenic
985782041 5:1876582-1876604 GGAGCGGCCCGGGGGCGGCGAGG - Intergenic
985896298 5:2751567-2751589 GGGCCGGGGCGGCGGCGGGGTGG + Exonic
985997090 5:3602953-3602975 GGAGCGGGGAGTGGGCGGGGTGG + Intergenic
985997100 5:3602989-3603011 GGAGCCGGGCCGGAGCGGAGTGG + Intergenic
986305253 5:6509506-6509528 GGACCGGGGAGGAGCAGGAGAGG - Intergenic
986569857 5:9153596-9153618 GGACAGTGGCGGGGGAGGGGGGG + Intronic
986608617 5:9546163-9546185 GGGGCGGGGCAGGGGCGGGGCGG - Intergenic
987084635 5:14457375-14457397 GGGGCGGGGCGGGGGGGGGGGGG - Intronic
988479598 5:31618883-31618905 AAAGCGGGGCGGGGGCGGGGTGG - Intergenic
988577789 5:32444066-32444088 GGGGCGGGGCGGGGCGGGAGAGG + Intronic
988949192 5:36241147-36241169 GAACGAGGGCGGGGGCGGCGAGG + Intronic
989103431 5:37840072-37840094 GGTCCGGGGTGGGGGAGGGGAGG + Intergenic
990007745 5:50963563-50963585 GGGCCCGGGCGGAGGAGGAGCGG - Intergenic
990557781 5:56952297-56952319 GGGCCGGCGCGGGGGCGGCGAGG - Intronic
991371610 5:65925708-65925730 CGGCGGGGGCGGGGGCGGGGCGG - Intergenic
991371639 5:65925813-65925835 GGAATGGGGCAGGGGCGGAGGGG - Intergenic
992105840 5:73448417-73448439 GGACCCGGGCTGGGGCGCAGAGG - Intergenic
992528927 5:77637324-77637346 GGACAAGCGCGGGTGCGGAGGGG - Intronic
992549115 5:77844808-77844830 GGACCAGGGCGGGGGCGTCCGGG - Intronic
992663734 5:78985398-78985420 GGCCCGGGTCGGAGGCGGCGGGG - Exonic
992939562 5:81750232-81750254 GGGCGGGGGCGGGGGCGGGTGGG - Intronic
993900645 5:93582110-93582132 GGAGAGGGGGGGAGGCGGAGAGG - Intergenic
993901072 5:93584658-93584680 GGAACGGAGCGCGGGGGGAGCGG + Exonic
994002379 5:94795243-94795265 GGACCTGGGCGGGGGTGGGGTGG + Intronic
995146632 5:108794517-108794539 GGAGGGGGGGGGGTGCGGAGGGG - Intronic
995512458 5:112922357-112922379 GGCGCTGGGCGGGGGAGGAGGGG - Exonic
996975167 5:129423877-129423899 GGAGCGGGGCATGGGGGGAGGGG + Intergenic
997013206 5:129903942-129903964 GGACCTGGGGCGGGGCAGAGTGG + Intergenic
997470578 5:134114918-134114940 GGACTCCGGCGGGGGCGGCGCGG + Exonic
997950974 5:138242226-138242248 GGTGCGGGGCTGGGGCGCAGCGG + Intergenic
997964227 5:138345126-138345148 GCACCGGGGCAGTGGTGGAGGGG + Exonic
998033930 5:138897296-138897318 GGGCGGGGGCGGGGGGGGGGGGG - Intronic
998166799 5:139848736-139848758 GGGCCGGCGCGGGGGAGGGGGGG + Intronic
998402126 5:141853507-141853529 GGACGGGGGTGGGAGTGGAGCGG - Exonic
998583573 5:143404050-143404072 GGAGCTGGGCGGGGGCGGGAAGG - Intronic
999242710 5:150136960-150136982 GGACCCGGGGGGCTGCGGAGTGG - Intronic
999322636 5:150624796-150624818 GGCGCGGGGCGGGGGTGGCGGGG + Intronic
999375005 5:151080846-151080868 GGCCCGGAGCGGGGATGGAGGGG - Intronic
999762376 5:154712638-154712660 GGACCAGGGCTGTGGAGGAGGGG + Intergenic
999989134 5:157033568-157033590 GGGCGGGGGCGGGGGCGGGTGGG + Intronic
1000082167 5:157858777-157858799 GGCCCGGGGCCGGGAAGGAGCGG + Intronic
1000320966 5:160133962-160133984 AGACCGGGGGGGGGGGGGCGGGG - Intergenic
1000357989 5:160419161-160419183 TGGCGGGGCCGGGGGCGGAGGGG + Exonic
1001154010 5:169257376-169257398 GGGGCGGGGTGGGGGCGGGGAGG - Intronic
1001159498 5:169300852-169300874 CGCACGGGGCGCGGGCGGAGCGG + Intronic
1001314713 5:170633742-170633764 GGGCGGGGGGCGGGGCGGAGGGG + Intronic
1001382828 5:171315343-171315365 GGACCGAGGCTGAGGCGGCGAGG - Intergenic
1001422163 5:171596386-171596408 GGCCGGGGGTGGGGGAGGAGGGG - Intergenic
1002006420 5:176238366-176238388 GGCTCGGGGCGGGGCCGGCGTGG + Exonic
1002063896 5:176642847-176642869 GGGCGGGGGGGGGGGGGGAGAGG - Intronic
1002091769 5:176810425-176810447 GGAGCGGGGCGGCGGCTGGGAGG - Intergenic
1002170356 5:177371106-177371128 GGGCCGGGGCCGGGGCCGGGCGG + Intronic
1002219958 5:177672271-177672293 GGCTCGGGGCGGGGCCGGCGGGG - Intergenic
1002498982 5:179634983-179635005 GGGCAGGGGCTGGGGAGGAGAGG - Intergenic
1002502694 5:179657541-179657563 GGGCAGGGGCTGGGGAGGAGAGG + Intergenic
1002524226 5:179806635-179806657 GGACCGGGGCCGGGGCGCAGGGG + Intronic
1002526694 5:179819319-179819341 AGACTGGGGGGGGGGCGGGGAGG - Intronic
1002527071 5:179820802-179820824 CGACGGTGGCGGGGGCGGGGAGG + Exonic
1002714331 5:181217094-181217116 GGGCGGGGGCGGGGGCGGAGGGG + Intergenic
1002927129 6:1611146-1611168 GGACAGGGGCTGGGGCGGCGAGG - Exonic
1003290678 6:4776283-4776305 GGGGCGGGGCGGCGGCGGGGCGG - Intronic
1003291268 6:4780399-4780421 GGGCGGGGGCGGGGGGGGGGGGG - Intronic
1003291274 6:4780405-4780427 GGGCGGGGGCGGGGGCGGGGGGG - Intronic
1003545014 6:7051858-7051880 GGGCCGGGCCGGGGGCTGCGCGG - Intergenic
1003783518 6:9456683-9456705 GGGGTGGGGCGGGGGAGGAGGGG - Intergenic
1004216779 6:13711242-13711264 GGGCGGCGGCGGGGGCGGCGGGG + Exonic
1004262097 6:14117606-14117628 GGGCGGGGACGGGGGCGAAGGGG + Intronic
1004399521 6:15275526-15275548 AGACGGGGGGGGGGGCGGGGGGG - Intronic
1004529374 6:16439358-16439380 GGGCGGGGCCGGGGGCGGGGCGG + Intronic
1004720563 6:18264605-18264627 GGCGCGGGGCGGGGGAGGCGGGG + Exonic
1005512102 6:26520818-26520840 GGGGCGGGGAGGGGGCGGGGCGG - Intergenic
1005953306 6:30647112-30647134 AGGCCGGGGCGGGGGGGTAGGGG - Exonic
1006027877 6:31158731-31158753 GAAACGGGGCTGGGGCGGAGTGG + Intronic
1006173439 6:32108352-32108374 GGTGGGGGGCGGGGGCGGCGAGG + Intronic
1006300728 6:33192497-33192519 GGCCGGGGGCGGGGGCGAGGTGG - Exonic
1006303203 6:33204857-33204879 GGACCGGGCACGGGGAGGAGAGG - Intronic
1006304129 6:33208667-33208689 GGGCGGGAGCGGGGGCGGAGAGG + Intronic
1006342334 6:33453456-33453478 GCAGAGGGGCGGGGGGGGAGGGG - Exonic
1006369213 6:33633811-33633833 GGGGCGGGGCGGGCGCGGGGCGG + Intronic
1006369218 6:33633822-33633844 GGCGCGGGGCGGGCGCGGGGCGG + Intronic
1006369235 6:33633854-33633876 GGGCCGGGGCGGGGCCAGGGAGG + Intronic
1006414076 6:33893077-33893099 GGGGCGGGGCCGGGGCGTAGAGG + Intergenic
1006466394 6:34197144-34197166 GGGGCGGGGGGGGGGCTGAGGGG - Intergenic
1006472229 6:34235649-34235671 GGCCCGGCGCGGAGGCGGGGTGG - Intergenic
1006512138 6:34527196-34527218 GGGCGGGGGCGGGGACGGCGAGG + Intronic
1006645488 6:35512067-35512089 GGAACGGGGTGGGGGAGGAGGGG - Intronic
1006860652 6:37169975-37169997 CGCGCGGGGCGGGGGCCGAGGGG + Intergenic
1006950672 6:37819436-37819458 ACGCCGGGGAGGGGGCGGAGCGG + Intergenic
1006950746 6:37819715-37819737 GAGACGGGGAGGGGGCGGAGAGG - Exonic
1007115913 6:39343137-39343159 GGACGGGGCTGGGGGTGGAGGGG + Intronic
1007363887 6:41376423-41376445 GGTCCGGGGTGGGGGAGGTGGGG - Intergenic
1007478306 6:42133814-42133836 AGACAGGGGCGGGGGCGGGGCGG + Intronic
1007479022 6:42137807-42137829 AGGCAGGGGCGGGGGCGGGGCGG + Intronic
1007479859 6:42142664-42142686 GGAGCTGGGCGGCGGCGGGGCGG - Intergenic
1007573775 6:42911635-42911657 GCTCGGGGGCGGGGGTGGAGGGG + Intergenic
1007625378 6:43243615-43243637 GGGCCGGGGCGGGGCGGGGGCGG - Intergenic
1007631438 6:43275435-43275457 GCCCCGGGGCGGGGGCGGGCTGG + Intronic
1007701687 6:43769806-43769828 GGACAGGGACGGGTGGGGAGAGG - Intergenic
1007784070 6:44270468-44270490 GGAGCGGGCGGGAGGCGGAGCGG + Exonic
1008932438 6:56954858-56954880 GGACGGGGGCGGGGGCGCCTGGG - Intergenic
1008945904 6:57096597-57096619 TTACCGGGGCGGGGGGGTAGGGG + Intronic
1008951191 6:57161481-57161503 TGAGGGGGGCGGGGGTGGAGGGG - Intronic
1011226613 6:85114981-85115003 GGGCGGGGGCGGGGGCGCCGGGG + Intergenic
1012137464 6:95577394-95577416 GGACTAGGGCGGGAGCGGCGCGG - Intergenic
1013099465 6:106974837-106974859 GGAGCGGGGCGGGGAAGGCGGGG - Intronic
1013106183 6:107028333-107028355 GGAGCGTGGGCGGGGCGGAGAGG - Exonic
1013117737 6:107115364-107115386 GGCCGGGGGTGGGGGCGGAGGGG - Intergenic
1013230431 6:108157457-108157479 GGAGCGGGGCAGCGGAGGAGGGG + Intronic
1013273045 6:108560307-108560329 CGACTGGGAAGGGGGCGGAGGGG + Intronic
1013372675 6:109483557-109483579 GGGCCGGGGCCGGGGCAGGGCGG + Intergenic
1013514920 6:110876006-110876028 GGAGCGGGGCGGGAGAGGTGCGG + Intronic
1013601831 6:111712412-111712434 TGACTGGGGCTGGGGAGGAGGGG - Intronic
1013978218 6:116100832-116100854 GGACCGGGCCGGACGCGGCGGGG - Exonic
1014045347 6:116877683-116877705 CTACTGGGGTGGGGGCGGAGGGG - Intronic
1014116826 6:117675793-117675815 GGACCGCGGCAGAGGCGGCGCGG - Exonic
1014632451 6:123803632-123803654 GGAGCGGGGCGCGGGCCGAGCGG - Intergenic
1015440371 6:133241040-133241062 GGGGCGGGGTGGGGGCGGCGCGG + Intronic
1016461768 6:144285877-144285899 GGAATGGGGCGGGGGCCGGGAGG + Intronic
1016658284 6:146544772-146544794 GGAGTGGGGGGGGGGCGGGGGGG - Intronic
1016714093 6:147204064-147204086 GGGCCGGGGCGGGCGAGCAGCGG + Intergenic
1016864023 6:148747962-148747984 GGATCCGGACTGGGGCGGAGTGG + Intronic
1016936358 6:149451481-149451503 TGAAAGGGGCGGGGGCAGAGAGG + Intronic
1017164185 6:151391703-151391725 CGGCTGGGGGGGGGGCGGAGGGG - Intergenic
1017234001 6:152100405-152100427 GGAACGGGGCGGGGGAGGAAGGG - Exonic
1017259672 6:152371678-152371700 GGAAGGGGGAGGGGGAGGAGAGG + Intronic
1017383490 6:153857022-153857044 GGGCAGGGGCGGGGGTGGTGGGG + Intergenic
1017665905 6:156720057-156720079 GGCCCAGGACGGGGGCGGGGCGG + Intergenic
1017671833 6:156777198-156777220 GGGCCGGGGCCGGGGCGGCTCGG - Intergenic
1017751236 6:157492193-157492215 GCTGGGGGGCGGGGGCGGAGGGG - Intronic
1017826641 6:158086682-158086704 GGCGAGGGGCGGGGGCGGGGAGG - Intronic
1018331056 6:162727772-162727794 GGCCGGGCGCGGGGGCGGGGAGG - Intronic
1018778997 6:167045352-167045374 GGGCCGCGGGGGGGGCGGGGAGG - Exonic
1018930839 6:168239404-168239426 TCACCGGGGCAGGGGCTGAGGGG + Intergenic
1019111935 6:169724032-169724054 GGGGCGGGGCCGGGGCGGCGGGG - Exonic
1019112133 6:169724604-169724626 GGGCCGGGCCGGGGGCCGCGGGG - Intronic
1019279436 7:192672-192694 AGACCGGGGCTGGGGGGAAGGGG - Intergenic
1019395802 7:816949-816971 GCGCGGGGTCGGGGGCGGAGCGG + Intronic
1019431298 7:1001051-1001073 GGAGCGGGACGGGGGCGGGGTGG - Intronic
1019472805 7:1230210-1230232 GGGCGGGGGCGGGGGAGGGGCGG + Intergenic
1019475107 7:1240653-1240675 GGGACGGGGCGGGGGCTGTGGGG + Intergenic
1019531688 7:1506571-1506593 GGAGGGGGGAGGGGGAGGAGGGG - Intergenic
1019531720 7:1506630-1506652 GGAGGGGGGAGGGGGAGGAGGGG - Intergenic
1019562148 7:1664588-1664610 GGACAGGGGTGGGGGTGGCGCGG - Intergenic
1019563938 7:1670543-1670565 GGAACTTGGCGGCGGCGGAGCGG + Intergenic
1019564618 7:1673264-1673286 GGATTGGGGTGGGGCCGGAGAGG + Intergenic
1019632728 7:2058400-2058422 GGAGAGGGGCGGGGCTGGAGAGG + Intronic
1019656787 7:2200199-2200221 GGCCCGGGGCGGGTGTGGGGTGG - Intronic
1019731503 7:2631915-2631937 GGACGGGCGGGGGTGCGGAGGGG + Intergenic
1019737923 7:2659634-2659656 GGACCGGGGAGGGGGCGGCCGGG + Intronic
1019769726 7:2876217-2876239 GCACCAGGGAGGGGCCGGAGTGG - Intergenic
1020035332 7:4960085-4960107 GGACCTGGGGGTGGGGGGAGTGG + Intergenic
1020106163 7:5423276-5423298 GGACCAGGGCCGGCGGGGAGGGG - Intronic
1020177891 7:5897556-5897578 CGACGGGGGGGGGGGCGGGGGGG + Intergenic
1020256052 7:6503708-6503730 TGAGCTGGGCGGGGCCGGAGCGG + Intronic
1020256057 7:6503719-6503741 GGGCCGGAGCGGGGCCGGATGGG + Intronic
1020274327 7:6615597-6615619 GGCCGGGGGCGGGGGCGCGGGGG - Exonic
1020274369 7:6615693-6615715 GGGCCGGGGCGGGGGCGGGGCGG - Exonic
1020278379 7:6637697-6637719 GGTCCGGGCAGGAGGCGGAGGGG + Intronic
1020311363 7:6871112-6871134 GGGCCGGGGGAGGGGGGGAGAGG + Intergenic
1020351506 7:7224462-7224484 GGTCAGGGGCGGGGGGTGAGGGG + Intronic
1021266037 7:18523892-18523914 GGAGCGGGGAGGGGGAGGTGGGG - Intronic
1021731272 7:23597672-23597694 GGGGCGCGGCGGGGGAGGAGCGG - Intronic
1021827947 7:24573379-24573401 CGACCGGAGCTGGGGCAGAGTGG + Exonic
1021958801 7:25852587-25852609 GAGCCGGGGCGGGGGCGCGGAGG - Intergenic
1021969361 7:25951375-25951397 GGCTGGGGGCGGGGGCGGGGTGG + Intergenic
1022207973 7:28180821-28180843 GGGCGGGGGCGGGGGCGGGGGGG + Intergenic
1022535975 7:31098694-31098716 GCAGCGGGGCGGGGGGGGGGGGG + Intronic
1022715147 7:32891883-32891905 GGGCGGGGGCGGGGGCGGCGGGG - Exonic
1023810411 7:43906757-43906779 GGGGCGGGGTGGGGGCGGGGCGG + Exonic
1023838650 7:44082863-44082885 GGACCTAGGCCCGGGCGGAGCGG + Intergenic
1023842274 7:44104320-44104342 GGCCCGGGGCGGGGGCGCCGGGG - Intergenic
1023969233 7:44979047-44979069 GGGGCAGGGCGGGGGCGGTGGGG - Exonic
1024257885 7:47551887-47551909 GGAGCGGGGCAGGGGTGGGGTGG + Intronic
1025211179 7:57020351-57020373 GGAGCGGGGCTGGGGCGGGGCGG - Intergenic
1025660776 7:63556496-63556518 GGAGCGGGGCTGGGGCGGGGCGG + Intergenic
1025665559 7:63581236-63581258 AGGCCGGGGAGGGGGCTGAGAGG - Intergenic
1025829830 7:65038828-65038850 AGGCCGGGGCGGACGCGGAGCGG + Intergenic
1025917085 7:65873828-65873850 AGGCCGGGGCGGACGCGGAGCGG + Intronic
1026308743 7:69166095-69166117 GGAGGGGGGAGGGGGAGGAGAGG + Intergenic
1026360432 7:69598049-69598071 GGGCGGGGGCGGGGGCGTGGAGG - Intergenic
1026458889 7:70596167-70596189 GGGCCGGGGCGGGGCTGGGGCGG + Intronic
1026840472 7:73667888-73667910 GGAGCGGAGCCGGGGCGGAGCGG + Exonic
1026850353 7:73719711-73719733 GGGCCGGGGCGGGGCCGGGCTGG - Intergenic
1026968096 7:74453243-74453265 GGAGCGGGGCGGGCGGGGGGCGG + Intergenic
1027222915 7:76225468-76225490 GGAAAGGGGCGGGGGGGGCGGGG - Intronic
1027228611 7:76260082-76260104 GGGCGGGGGTGGGGGCGGTGAGG - Intronic
1028223189 7:88220069-88220091 GGGCGGGGCAGGGGGCGGAGAGG - Exonic
1028373422 7:90119621-90119643 GCTCCGGGGCGGAGGCGGGGGGG - Intergenic
1028929064 7:96392676-96392698 GGCCAGGGGCGGGGGCGGAATGG - Intergenic
1029375036 7:100172037-100172059 GGCCCGGGGCGGGGACGGTGTGG - Intronic
1029446306 7:100614811-100614833 GGACCTGGGCTGGGCAGGAGTGG + Intronic
1029456821 7:100675871-100675893 GAACTGGGGCGGGGGGGGCGGGG - Intronic
1029612449 7:101634327-101634349 GGACGGGAGCTGGGGAGGAGGGG - Intergenic
1029640449 7:101816500-101816522 GGAGCGGGGAGCGGGCGGCGGGG + Intronic
1029644372 7:101844177-101844199 GGGCGGGGGCGGGGGCGGGGAGG - Intronic
1029708287 7:102286726-102286748 GGCCGGGGGCGGGGCCTGAGCGG + Intronic
1029708330 7:102286811-102286833 CGGCGGGGGCGGGGGCGGGGCGG + Intronic
1029711120 7:102300571-102300593 GGACCGGGGCGGCTGCGGCGGGG - Exonic
1029739603 7:102483855-102483877 GGAGCTGAGCGGGGGCGCAGAGG - Exonic
1029746428 7:102517808-102517830 AGGCGGGGGCGGGGGCGGGGCGG + Intergenic
1029757604 7:102583034-102583056 GGAGCTGAGCGGGGGCGCAGAGG - Exonic
1029764365 7:102616787-102616809 AGGCGGGGGCGGGGGCGGGGCGG + Intronic
1029775541 7:102682095-102682117 GGAGCTGAGCGGGGGCGCAGAGG - Intergenic
1030033461 7:105388971-105388993 GGGCGGGGGCGGGGCCGGACGGG - Intronic
1031045430 7:116881784-116881806 GGACCAGGGCGGGGGTGGAGGGG - Intronic
1031361834 7:120857379-120857401 GGGCGGGGGCGGGGGCGAGGGGG + Intronic
1031484097 7:122307511-122307533 GGAGAGGGGAGGGGGAGGAGAGG - Intronic
1031689224 7:124766354-124766376 GGGGCGGGGCGGGGGAGGGGCGG + Intergenic
1031887175 7:127254139-127254161 AGAGCGGGGCGCGGGGGGAGAGG + Intergenic
1032085122 7:128879789-128879811 TGACCGGGGCCGGAGCGGTGTGG - Exonic
1032091784 7:128915049-128915071 GGCCTGGGGCTGGGGCTGAGGGG - Intergenic
1032130621 7:129224902-129224924 GGGGCGGGGCGGGGCTGGAGGGG + Intergenic
1032167645 7:129558265-129558287 GAGCCGGGGTGGGGGCGGGGAGG - Intergenic
1032344328 7:131105844-131105866 GGGCCGGGGCGCGGGAGGCGAGG - Intergenic
1032391299 7:131556737-131556759 GGGCCGGGGCCGGGGCTGGGCGG + Intronic
1032675633 7:134127601-134127623 GGACCAGGGCGAGGGCGAGGCGG + Exonic
1033220380 7:139523612-139523634 GGGGCGGGGCAGGGGCGGAGAGG - Intergenic
1033227388 7:139572769-139572791 GGGCAGGGGCGGGGGGGGGGGGG - Exonic
1034263764 7:149772148-149772170 AAACCGGGGTGGGGGAGGAGAGG - Intronic
1034422129 7:150995800-150995822 GGACGGGGGAGAGGGAGGAGGGG - Intronic
1034422172 7:150995899-150995921 GGACAGGGGAGAGGGAGGAGGGG - Intronic
1034569544 7:151944294-151944316 GGCCCGGGGCTGGGGCTGTGGGG - Intergenic
1034659903 7:152759951-152759973 GGAGCGGGGCCGCGGAGGAGCGG - Intronic
1034849413 7:154480006-154480028 GGGCAGGGGCGGGGTGGGAGTGG - Intronic
1034849415 7:154480012-154480034 GGGGCGGGGCAGGGGCGGGGTGG - Intronic
1034911610 7:155002782-155002804 GGACGGGGACGGGGACGGACGGG + Intronic
1035167593 7:157000580-157000602 TGGCGGGGGCGGGGGCGGGGTGG + Intronic
1035221005 7:157406546-157406568 GGACCTGGCCGGGGGCGGAGTGG + Intronic
1035256680 7:157633656-157633678 GGACCTGGGCAGGGCCTGAGTGG + Intronic
1035315745 7:157996912-157996934 GGCCCGGGGCGGGTGTGGGGAGG + Intronic
1035318883 7:158015533-158015555 GGTGAGGGGCGGGGGCGGTGAGG - Intronic
1035404385 7:158588129-158588151 GCACCGGGCCGGGCGGGGAGCGG - Intergenic
1035574819 8:697680-697702 GGGCGGGGGCGGGGGCTGTGTGG - Intronic
1037308474 8:17530176-17530198 GGACCGGGGATGGGGGGCAGGGG - Intronic
1037825295 8:22156802-22156824 GGACTGCGGCGCGGGCGGCGGGG + Exonic
1037876590 8:22551735-22551757 GGGCCGGGGCTGGGCCGGAGAGG - Exonic
1037886714 8:22599553-22599575 GGAGCGGGGCTGGGGGGGCGGGG - Intronic
1037947316 8:22997447-22997469 GGGGCGGGGCGGGGGCTGTGGGG + Intronic
1038535302 8:28349225-28349247 GGACCTGGGCGTGGGGAGAGGGG + Exonic
1038807991 8:30812474-30812496 GGCCGGGGGCGGGTGGGGAGGGG - Exonic
1039091888 8:33839739-33839761 GGACTGGGGTTGGGGAGGAGTGG - Intergenic
1039554651 8:38467630-38467652 GGCCCGGGGCGAAGGCGGCGAGG - Intronic
1039575857 8:38623615-38623637 GGTCGGGGGCTGGGGAGGAGAGG - Intergenic
1039918664 8:41877710-41877732 GGAGCCAGGCGGGGGCGAAGTGG + Intronic
1040610438 8:48977520-48977542 GGCCCGCGGTGTGGGCGGAGAGG - Intergenic
1041464571 8:58145813-58145835 GGGGCGGGGCGGGGGCGCTGCGG + Intronic
1042267712 8:66925646-66925668 GCTCTGGGGAGGGGGCGGAGGGG + Intergenic
1042611923 8:70608887-70608909 GGATGGGGGTGGGGACGGAGAGG - Intronic
1042903178 8:73747501-73747523 AGACGGGGGAGGGGGCGGGGAGG + Intronic
1042962845 8:74321427-74321449 GGACGGGGGCGGCGTCGGACTGG - Intronic
1044873905 8:96645496-96645518 GGCCAGGGGCGGGGGCAGAGGGG + Intronic
1044988535 8:97775770-97775792 GGGACGGGGAGGGGGCGGGGCGG - Exonic
1045063473 8:98427000-98427022 GAGCCGGGGCGGGAGCAGAGCGG - Exonic
1045324625 8:101109129-101109151 GGACCTGGGCGGAGGGGGGGGGG - Intergenic
1046819803 8:118622161-118622183 GTGGCGGGGCGGGGGGGGAGGGG + Intergenic
1047292284 8:123541106-123541128 GGCCCGCGACGGGGGCGGCGGGG + Exonic
1047752998 8:127896772-127896794 GGTCGGGGGCGGGGGGGGGGAGG - Intergenic
1047998609 8:130358711-130358733 GGGGCGGGGCGCGGGCGGGGAGG - Intronic
1049103609 8:140597475-140597497 GGCCTGGGGCGGGGGGGGGGGGG - Intronic
1049194625 8:141308483-141308505 GGGGCGCGGCGGGGGCGGGGCGG - Intergenic
1049194676 8:141308596-141308618 GGCCGGGGCCGGGGGCGTAGCGG - Intergenic
1049217748 8:141415634-141415656 GGGGCGGGGCGGGGGGGCAGGGG + Intronic
1049404100 8:142443943-142443965 GGACCTGGGTGGAGGCGGACCGG + Intergenic
1049438573 8:142598902-142598924 GGATGGGGGCAGGGGCCGAGTGG - Intergenic
1049478610 8:142808338-142808360 GGACAGGGGCTGGGGCGGATGGG + Intergenic
1049532241 8:143160348-143160370 GAGCCGGGGCGGGGGCCGCGCGG + Intronic
1049639340 8:143707598-143707620 TGGCCGGGCCGGGGGCGGGGTGG - Intronic
1049688792 8:143949864-143949886 GGACAGGAGAGGAGGCGGAGGGG + Intronic
1049693681 8:143973568-143973590 GGGGCGGGGCGGGGGCGGGGCGG - Intronic
1049699908 8:144005850-144005872 GGACGGGGGCAAGAGCGGAGGGG - Intronic
1049708088 8:144051867-144051889 GGGTGGGGGCGGGGGCGGGGAGG + Intronic
1049843753 8:144789998-144790020 GGCCGGGGGCGGGGGTGGTGGGG - Intronic
1049867865 8:144950622-144950644 GGAGCGCGGGGGGGGCGGGGCGG - Intronic
1050094221 9:2047228-2047250 GGCCCGGGGCCGGAGCTGAGCGG + Exonic
1050905129 9:10993991-10994013 GAAACGGGGGGGGGGCGGGGGGG + Intergenic
1051170273 9:14314170-14314192 GGGCCGGGGTGGGGGCGGGGTGG + Intronic
1051936344 9:22447145-22447167 CGCCGGGGACGGGGGCGGAGGGG - Exonic
1052362240 9:27573511-27573533 GGGCCGGGGCGTGGTCGGGGCGG - Intronic
1053009204 9:34623837-34623859 GGCCAGGGGCGGGAGCGGAAGGG - Intronic
1053163528 9:35829419-35829441 GGGCGGGGGCGGGGCCGGACAGG - Intronic
1053214242 9:36257977-36257999 GGAGCGGGGCGGGGCGAGAGAGG - Intronic
1053239942 9:36487405-36487427 CGGCCGGGGCGGCGGCGGTGGGG + Intronic
1053382462 9:37660149-37660171 GGATAGGGGCTGGGGAGGAGAGG + Intronic
1053530156 9:38873140-38873162 AGACCTGGTGGGGGGCGGAGGGG + Intergenic
1054255095 9:62802736-62802758 GGACTGGAGCGTGGGCGGAAAGG - Intergenic
1054336215 9:63812873-63812895 GGACTGGAGCGTGGGCGGAAAGG + Intergenic
1054635977 9:67490793-67490815 AGACCTGGTGGGGGGCGGAGGGG - Intergenic
1056168412 9:83959947-83959969 GAACCGGGGCGGGGGGGCGGCGG - Intergenic
1056643174 9:88388288-88388310 GGGGCGGGGCGGGGCCGGCGAGG - Intergenic
1056773932 9:89498016-89498038 GGGCCGGGGAGGGGGTGGCGGGG + Intronic
1056839440 9:89986705-89986727 GGTCGGGGGCAGGGGCAGAGGGG - Intergenic
1056852267 9:90094592-90094614 GGACCGGGGTGGGCGGGGGGCGG + Intergenic
1056985666 9:91361921-91361943 GGCGCCGGGCGGGGGCGGAGCGG - Intergenic
1057130815 9:92653386-92653408 GGACAGGGGTGGTGGTGGAGGGG - Intronic
1057257973 9:93566673-93566695 GGACCTGCGCGGTGGCGGACGGG - Intergenic
1057470172 9:95349854-95349876 GGACCCGGGCGGGGACAGAGCGG - Intergenic
1057630670 9:96716523-96716545 GGGACGGGGAGGGGGAGGAGAGG + Intergenic
1057752427 9:97803557-97803579 GGAGCGGGGACGGGGCGGGGCGG - Intergenic
1057772862 9:97983502-97983524 TTTCCGCGGCGGGGGCGGAGGGG - Exonic
1057797432 9:98169001-98169023 GGACCTGGGACGGGGTGGAGGGG + Intronic
1057883000 9:98807596-98807618 GGGGCGGGCCGGGGGCGGGGCGG + Intergenic
1059108991 9:111536701-111536723 GTACGGGGGCGGGGGGGGTGCGG - Intronic
1059230677 9:112718306-112718328 GGCCCGGGGCGGGGGAGGGGCGG + Intergenic
1060106480 9:120876452-120876474 GGACGGAGGCGGGGGCTGGGGGG - Intronic
1060106715 9:120877228-120877250 GGGGCGGGGCGGGGGCGCCGCGG + Exonic
1060182857 9:121546046-121546068 GGGACCGGGCGGGGGTGGAGAGG - Intergenic
1060550447 9:124482470-124482492 GGAGCAGGGAGGGGGCGGGGCGG + Exonic
1060945913 9:127569199-127569221 GGACCGAGGGCGGGGCGGGGCGG - Intronic
1060980050 9:127786423-127786445 GGCCCGTGGTGGGGGCGGGGAGG + Intronic
1060987005 9:127825613-127825635 GGACCGGAGAGGGGGCGGGGGGG + Intronic
1061003797 9:127917051-127917073 GGGCCGGGGCCGGCGAGGAGGGG + Intergenic
1061123160 9:128656620-128656642 GGCCCGGGGCCGGGGCGGCCAGG - Exonic
1061231617 9:129319049-129319071 GGGCCAGGGCGGGGGCGACGGGG - Intergenic
1061262937 9:129490001-129490023 GGACCGGGGCAGGTGCTGGGTGG - Intergenic
1061264501 9:129497354-129497376 AGGCCCGGGCGGGGGCGGGGAGG + Intergenic
1061380588 9:130254422-130254444 GAAGCGGGGCGGGGGCGGGGTGG - Intergenic
1061449212 9:130659621-130659643 GGACAGGGGTGGGGTGGGAGAGG + Intergenic
1061559654 9:131394278-131394300 GGGCCGGGGCCGGGGCGTGGGGG + Intronic
1061608940 9:131733350-131733372 AAGCCGGGGCGGGGGCGGGGGGG + Intronic
1062017259 9:134297114-134297136 GGGCCGGGGCGGGCGGGGACAGG - Intergenic
1062230625 9:135479875-135479897 GGCGCGGGGAGGGGGCGCAGGGG - Exonic
1062234352 9:135500846-135500868 GACCCGGGGCGAGCGCGGAGGGG + Intronic
1062325461 9:136010491-136010513 GGCCCTGGGCGGGGGAGCAGGGG + Exonic
1062337556 9:136078966-136078988 GGAGAGGGGCGGCGGCGGCGCGG - Intronic
1062341416 9:136095313-136095335 GCACCGCGGCGGGGGCGGGGCGG + Intergenic
1062363738 9:136199232-136199254 GCACCCGGGCTGGGGTGGAGGGG + Intronic
1062421122 9:136483227-136483249 GGCGAGGGGCGGGGGCAGAGGGG - Intronic
1062461878 9:136665721-136665743 GGGCGGGGCCGGGGGCGGGGCGG + Intronic
1062461881 9:136665726-136665748 GGGCCGGGGGCGGGGCGGGGCGG + Intronic
1062491867 9:136808593-136808615 GGAGCGGGTCGGCGGCGGCGGGG + Intronic
1062529040 9:136991980-136992002 GAGCCGGGGCGGGGGCGGGAGGG + Intergenic
1062533292 9:137010937-137010959 GGGGTGGGGCGGGGGCGGGGCGG - Intronic
1062535087 9:137017926-137017948 GGGCTGGGGCTGGGGCTGAGTGG - Intronic
1062565798 9:137163468-137163490 GGGCCGGGGCGGGGCCTGCGGGG - Intronic
1062574555 9:137200199-137200221 GGGCGGGGGCCGGGGCGGCGCGG + Exonic
1062595045 9:137295658-137295680 GGACCGGGCCGGGGCGGGCGGGG + Intergenic
1062621192 9:137423264-137423286 CGGCCGGGGCGGGGGCCGAATGG + Intergenic
1062696218 9:137877653-137877675 GGGCCGGGGCGGGGCGGGGGCGG + Intergenic
1062696975 9:137880510-137880532 AGGCCGGGGCGGGGGCAGGGAGG + Intronic
1203752935 Un_GL000218v1:97211-97233 GGACCCTGGCGGGGGCTGGGAGG - Intergenic
1203469127 Un_GL000220v1:108573-108595 GGACCGGTGCGCGGGCGCTGCGG + Intergenic
1203471758 Un_GL000220v1:118238-118260 GAAACGGGGCGCGGCCGGAGAGG + Intergenic
1203473040 Un_GL000220v1:125185-125207 GGTGCGGGGTGGGGACGGAGGGG + Intergenic
1203476948 Un_GL000220v1:152545-152567 GGACCGGTGCGCGGGCGCTGCGG + Intergenic
1203712341 Un_KI270742v1:109758-109780 GGACCCTGGCGGGGGCTGGGAGG - Intergenic
1203538869 Un_KI270743v1:68429-68451 GGACCCTGGCGGGGGCTGGGAGG + Intergenic
1185469415 X:373714-373736 GGGCCGGGCCGGGGCCGGCGGGG + Intronic
1185621802 X:1454260-1454282 GGACCAGGGCGGGCGCTGTGAGG + Intergenic
1186084533 X:5972752-5972774 GGTGGGGGGCGGGGGCGGGGTGG + Intronic
1186466230 X:9786340-9786362 GGGCCGGGGCTGGCGGGGAGGGG - Intergenic
1187419549 X:19122546-19122568 GGAGCGGGCCGGGAGCGGCGGGG - Exonic
1187471982 X:19577874-19577896 GGCACGGGGTGGCGGCGGAGAGG - Intronic
1187507272 X:19887765-19887787 GGGCGGGGGCGGGGCCGGAGAGG + Intergenic
1187584004 X:20639784-20639806 GGAGGGGGGAGGGGGAGGAGAGG - Intergenic
1187862400 X:23694785-23694807 GGATGGGGGTGGGGGCGGGGGGG + Intergenic
1188542664 X:31266973-31266995 GGGCCGGGGAGGGGGCGCTGCGG + Intronic
1189197641 X:39165695-39165717 GGTTGGGGGCGGGCGCGGAGTGG - Intergenic
1189446453 X:41085524-41085546 TGACGGGGCCGGGTGCGGAGAGG - Intergenic
1190041813 X:47078239-47078261 GGACGGGGACGGGGACGGGGCGG + Intergenic
1190050500 X:47145523-47145545 GGCCCGGGGCGGGGACGTAGAGG + Intronic
1190368162 X:49717002-49717024 TTACGGGGGCGGGGGGGGAGGGG - Intergenic
1190404045 X:50068467-50068489 GGGGCGGGGTGGGGGTGGAGTGG - Intronic
1190761402 X:53440939-53440961 CGACCTTGGCGGGCGCGGAGCGG - Intergenic
1192298776 X:69879071-69879093 GGGGCGGGGAGGGGGCGGCGCGG - Intronic
1192544819 X:72004673-72004695 GGACTGGGGCGGGGCGGTAGGGG - Intergenic
1194133718 X:90112590-90112612 GGAGCCGGGCGGGGGAGGACGGG - Intergenic
1195238980 X:102932276-102932298 GGAGCGGTGGGGGGGCGGGGGGG + Intergenic
1195239276 X:102935045-102935067 GGGCGGGGGCGGGGGAGGAGGGG + Intergenic
1196124335 X:112082941-112082963 GGGGCGGGGCGGGGGAGGCGGGG + Intergenic
1197709348 X:129654660-129654682 GAGCCGGCGCGGGGGAGGAGAGG + Exonic
1197749901 X:129957264-129957286 GGGCAGGGGCGGAGGGGGAGGGG - Intergenic
1197749906 X:129957270-129957292 GGGCCTGGGCAGGGGCGGAGGGG - Intergenic
1197758678 X:130013444-130013466 GGACTGGGGCAGGGACGGAGAGG - Exonic
1197892336 X:131279555-131279577 GGAGTGGGGAGGGGGCGGGGGGG - Intronic
1197991466 X:132322725-132322747 GGGCGGGGGCGGGGGTGGCGTGG - Intergenic
1198221092 X:134603206-134603228 GGACTGGGGATGGGGAGGAGTGG + Intronic
1198242157 X:134797030-134797052 GCACCGCGGCGGCGGCTGAGAGG - Intronic
1198534501 X:137573753-137573775 GGGCCGGGGCGGAGGCGGCGAGG + Intronic
1199736792 X:150693325-150693347 GGGCGGGAGCGGGGGCGGGGAGG - Intronic
1200047696 X:153411448-153411470 GGGCCGGGGCGGCGGCAGCGTGG - Intergenic
1200097996 X:153673195-153673217 GGACCTGGACGGGGGAGGGGAGG - Intronic
1200147790 X:153935321-153935343 GGGAGGGGGCGGGGGCGGGGCGG + Exonic
1200164911 X:154029455-154029477 GGACAGGGGAGGGGGCAAAGGGG - Intronic
1200217530 X:154374675-154374697 GGCGCGGGGCGGGCGCGGGGCGG - Intergenic
1200217537 X:154374686-154374708 GGGCCGGGCCGGGCGCGGGGCGG - Intergenic
1200292367 X:154885882-154885904 CAACCGGGGTGGGGACGGAGAGG + Intronic
1200339205 X:155381619-155381641 CAACCGGGGTGGGGACGGAGAGG + Intergenic
1200347264 X:155459073-155459095 CAACCGGGGTGGGGACGGAGAGG - Intergenic
1200683944 Y:6244165-6244187 GGGCAGGGGCGGGGGCAGGGTGG + Intergenic
1201048691 Y:9910221-9910243 GGGCAGGGGCGGGGGCAGGGTGG - Intergenic
1201166578 Y:11214781-11214803 GGACCCTGGCGGGGGCTGGGAGG - Intergenic
1202372085 Y:24205512-24205534 GGGGCAGGGCGAGGGCGGAGAGG - Intergenic
1202498700 Y:25464604-25464626 GGGGCAGGGCGAGGGCGGAGAGG + Intergenic