ID: 922825661

View in Genome Browser
Species Human (GRCh38)
Location 1:228516372-228516394
Sequence CTCCATTTAAAAATGGGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 15601
Summary {0: 4, 1: 85, 2: 752, 3: 3178, 4: 11582}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922825661_922825664 5 Left 922825661 1:228516372-228516394 CCTTTGCCCATTTTTAAATGGAG 0: 4
1: 85
2: 752
3: 3178
4: 11582
Right 922825664 1:228516400-228516422 TTTAGCTTGTTGAATTGTTTAGG No data
922825661_922825665 22 Left 922825661 1:228516372-228516394 CCTTTGCCCATTTTTAAATGGAG 0: 4
1: 85
2: 752
3: 3178
4: 11582
Right 922825665 1:228516417-228516439 TTTAGGTTCCTTATAGATTCTGG 0: 14
1: 744
2: 4013
3: 8915
4: 19496

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922825661 Original CRISPR CTCCATTTAAAAATGGGCAA AGG (reversed) Intergenic
Too many off-targets to display for this crispr