ID: 922830201

View in Genome Browser
Species Human (GRCh38)
Location 1:228548974-228548996
Sequence TTGTAATGATAAAGACACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922830201_922830210 21 Left 922830201 1:228548974-228548996 CCCAGGTGTCTTTATCATTACAA No data
Right 922830210 1:228549018-228549040 CTCTTCCATTAGAGTGCCTGGGG No data
922830201_922830204 -5 Left 922830201 1:228548974-228548996 CCCAGGTGTCTTTATCATTACAA No data
Right 922830204 1:228548992-228549014 TACAATGCCTTGAGCCGGCCAGG No data
922830201_922830203 -10 Left 922830201 1:228548974-228548996 CCCAGGTGTCTTTATCATTACAA No data
Right 922830203 1:228548987-228549009 ATCATTACAATGCCTTGAGCCGG No data
922830201_922830208 19 Left 922830201 1:228548974-228548996 CCCAGGTGTCTTTATCATTACAA No data
Right 922830208 1:228549016-228549038 GTCTCTTCCATTAGAGTGCCTGG No data
922830201_922830209 20 Left 922830201 1:228548974-228548996 CCCAGGTGTCTTTATCATTACAA No data
Right 922830209 1:228549017-228549039 TCTCTTCCATTAGAGTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922830201 Original CRISPR TTGTAATGATAAAGACACCT GGG (reversed) Intergenic
No off target data available for this crispr