ID: 922830202

View in Genome Browser
Species Human (GRCh38)
Location 1:228548975-228548997
Sequence ATTGTAATGATAAAGACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922830202_922830208 18 Left 922830202 1:228548975-228548997 CCAGGTGTCTTTATCATTACAAT No data
Right 922830208 1:228549016-228549038 GTCTCTTCCATTAGAGTGCCTGG No data
922830202_922830210 20 Left 922830202 1:228548975-228548997 CCAGGTGTCTTTATCATTACAAT No data
Right 922830210 1:228549018-228549040 CTCTTCCATTAGAGTGCCTGGGG No data
922830202_922830209 19 Left 922830202 1:228548975-228548997 CCAGGTGTCTTTATCATTACAAT No data
Right 922830209 1:228549017-228549039 TCTCTTCCATTAGAGTGCCTGGG No data
922830202_922830204 -6 Left 922830202 1:228548975-228548997 CCAGGTGTCTTTATCATTACAAT No data
Right 922830204 1:228548992-228549014 TACAATGCCTTGAGCCGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922830202 Original CRISPR ATTGTAATGATAAAGACACC TGG (reversed) Intergenic
No off target data available for this crispr