ID: 922830204

View in Genome Browser
Species Human (GRCh38)
Location 1:228548992-228549014
Sequence TACAATGCCTTGAGCCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922830202_922830204 -6 Left 922830202 1:228548975-228548997 CCAGGTGTCTTTATCATTACAAT No data
Right 922830204 1:228548992-228549014 TACAATGCCTTGAGCCGGCCAGG No data
922830199_922830204 16 Left 922830199 1:228548953-228548975 CCATTAGAATGCATGGCGTTGCC No data
Right 922830204 1:228548992-228549014 TACAATGCCTTGAGCCGGCCAGG No data
922830198_922830204 17 Left 922830198 1:228548952-228548974 CCCATTAGAATGCATGGCGTTGC No data
Right 922830204 1:228548992-228549014 TACAATGCCTTGAGCCGGCCAGG No data
922830201_922830204 -5 Left 922830201 1:228548974-228548996 CCCAGGTGTCTTTATCATTACAA No data
Right 922830204 1:228548992-228549014 TACAATGCCTTGAGCCGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922830204 Original CRISPR TACAATGCCTTGAGCCGGCC AGG Intergenic
No off target data available for this crispr