ID: 922830209

View in Genome Browser
Species Human (GRCh38)
Location 1:228549017-228549039
Sequence TCTCTTCCATTAGAGTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922830202_922830209 19 Left 922830202 1:228548975-228548997 CCAGGTGTCTTTATCATTACAAT No data
Right 922830209 1:228549017-228549039 TCTCTTCCATTAGAGTGCCTGGG No data
922830201_922830209 20 Left 922830201 1:228548974-228548996 CCCAGGTGTCTTTATCATTACAA No data
Right 922830209 1:228549017-228549039 TCTCTTCCATTAGAGTGCCTGGG No data
922830205_922830209 -5 Left 922830205 1:228548999-228549021 CCTTGAGCCGGCCAGGAGTCTCT No data
Right 922830209 1:228549017-228549039 TCTCTTCCATTAGAGTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922830209 Original CRISPR TCTCTTCCATTAGAGTGCCT GGG Intergenic
No off target data available for this crispr