ID: 922830257

View in Genome Browser
Species Human (GRCh38)
Location 1:228549375-228549397
Sequence TTCAATGCCTACAGTGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922830253_922830257 -5 Left 922830253 1:228549357-228549379 CCCAGGTGTCTCTATCATTTCAA No data
Right 922830257 1:228549375-228549397 TTCAATGCCTACAGTGGGTCAGG No data
922830250_922830257 28 Left 922830250 1:228549324-228549346 CCAAAATCTCTCGTATTAGATTG No data
Right 922830257 1:228549375-228549397 TTCAATGCCTACAGTGGGTCAGG No data
922830254_922830257 -6 Left 922830254 1:228549358-228549380 CCAGGTGTCTCTATCATTTCAAT No data
Right 922830257 1:228549375-228549397 TTCAATGCCTACAGTGGGTCAGG No data
922830252_922830257 5 Left 922830252 1:228549347-228549369 CCTGAGATCGCCCAGGTGTCTCT No data
Right 922830257 1:228549375-228549397 TTCAATGCCTACAGTGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922830257 Original CRISPR TTCAATGCCTACAGTGGGTC AGG Intergenic
No off target data available for this crispr