ID: 922831645

View in Genome Browser
Species Human (GRCh38)
Location 1:228557390-228557412
Sequence CCGGGCGGGCCCGGAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922831625_922831645 25 Left 922831625 1:228557342-228557364 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922831645 1:228557390-228557412 CCGGGCGGGCCCGGAGGCCTGGG No data
922831626_922831645 24 Left 922831626 1:228557343-228557365 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922831645 1:228557390-228557412 CCGGGCGGGCCCGGAGGCCTGGG No data
922831632_922831645 3 Left 922831632 1:228557364-228557386 CCGCCCGTTTGGCGGGAGCCGTG No data
Right 922831645 1:228557390-228557412 CCGGGCGGGCCCGGAGGCCTGGG No data
922831631_922831645 4 Left 922831631 1:228557363-228557385 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922831645 1:228557390-228557412 CCGGGCGGGCCCGGAGGCCTGGG No data
922831635_922831645 -1 Left 922831635 1:228557368-228557390 CCGTTTGGCGGGAGCCGTGGCAC No data
Right 922831645 1:228557390-228557412 CCGGGCGGGCCCGGAGGCCTGGG No data
922831627_922831645 23 Left 922831627 1:228557344-228557366 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922831645 1:228557390-228557412 CCGGGCGGGCCCGGAGGCCTGGG No data
922831634_922831645 0 Left 922831634 1:228557367-228557389 CCCGTTTGGCGGGAGCCGTGGCA No data
Right 922831645 1:228557390-228557412 CCGGGCGGGCCCGGAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922831645 Original CRISPR CCGGGCGGGCCCGGAGGCCT GGG Intergenic
No off target data available for this crispr