ID: 922831700

View in Genome Browser
Species Human (GRCh38)
Location 1:228557598-228557620
Sequence CACCCTTCCAAACCGGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922831700_922831705 -3 Left 922831700 1:228557598-228557620 CCTTCACCCGGTTTGGAAGGGTG No data
Right 922831705 1:228557618-228557640 GTGCGACGACGGCGCCCGATGGG No data
922831700_922831711 24 Left 922831700 1:228557598-228557620 CCTTCACCCGGTTTGGAAGGGTG No data
Right 922831711 1:228557645-228557667 TTGAATCGCCTGGGCGTTCCGGG No data
922831700_922831710 23 Left 922831700 1:228557598-228557620 CCTTCACCCGGTTTGGAAGGGTG No data
Right 922831710 1:228557644-228557666 ATTGAATCGCCTGGGCGTTCCGG No data
922831700_922831708 14 Left 922831700 1:228557598-228557620 CCTTCACCCGGTTTGGAAGGGTG No data
Right 922831708 1:228557635-228557657 GATGGGTGAATTGAATCGCCTGG No data
922831700_922831713 30 Left 922831700 1:228557598-228557620 CCTTCACCCGGTTTGGAAGGGTG No data
Right 922831713 1:228557651-228557673 CGCCTGGGCGTTCCGGGAGCGGG No data
922831700_922831704 -4 Left 922831700 1:228557598-228557620 CCTTCACCCGGTTTGGAAGGGTG No data
Right 922831704 1:228557617-228557639 GGTGCGACGACGGCGCCCGATGG No data
922831700_922831712 29 Left 922831700 1:228557598-228557620 CCTTCACCCGGTTTGGAAGGGTG No data
Right 922831712 1:228557650-228557672 TCGCCTGGGCGTTCCGGGAGCGG No data
922831700_922831709 15 Left 922831700 1:228557598-228557620 CCTTCACCCGGTTTGGAAGGGTG No data
Right 922831709 1:228557636-228557658 ATGGGTGAATTGAATCGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922831700 Original CRISPR CACCCTTCCAAACCGGGTGA AGG (reversed) Intergenic
No off target data available for this crispr