ID: 922832122

View in Genome Browser
Species Human (GRCh38)
Location 1:228609372-228609394
Sequence CCGGGCGGGCCCGGAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922832102_922832122 25 Left 922832102 1:228609324-228609346 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922832122 1:228609372-228609394 CCGGGCGGGCCCGGAGGCCTGGG No data
922832103_922832122 24 Left 922832103 1:228609325-228609347 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922832122 1:228609372-228609394 CCGGGCGGGCCCGGAGGCCTGGG No data
922832108_922832122 4 Left 922832108 1:228609345-228609367 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922832122 1:228609372-228609394 CCGGGCGGGCCCGGAGGCCTGGG No data
922832104_922832122 23 Left 922832104 1:228609326-228609348 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922832122 1:228609372-228609394 CCGGGCGGGCCCGGAGGCCTGGG No data
922832109_922832122 3 Left 922832109 1:228609346-228609368 CCGCCCGTTTGGCGGGAGCCGTG No data
Right 922832122 1:228609372-228609394 CCGGGCGGGCCCGGAGGCCTGGG No data
922832112_922832122 -1 Left 922832112 1:228609350-228609372 CCGTTTGGCGGGAGCCGTGGCAC No data
Right 922832122 1:228609372-228609394 CCGGGCGGGCCCGGAGGCCTGGG No data
922832111_922832122 0 Left 922832111 1:228609349-228609371 CCCGTTTGGCGGGAGCCGTGGCA No data
Right 922832122 1:228609372-228609394 CCGGGCGGGCCCGGAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922832122 Original CRISPR CCGGGCGGGCCCGGAGGCCT GGG Intergenic
No off target data available for this crispr