ID: 922832178

View in Genome Browser
Species Human (GRCh38)
Location 1:228609580-228609602
Sequence CACCCTTCCAAACCGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922832178_922832193 30 Left 922832178 1:228609580-228609602 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922832193 1:228609633-228609655 CGCCTGGGCGTTCCGGGAGCGGG No data
922832178_922832184 -4 Left 922832178 1:228609580-228609602 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922832184 1:228609599-228609621 GGTGCGACGACGGCGCCCGATGG No data
922832178_922832192 29 Left 922832178 1:228609580-228609602 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922832192 1:228609632-228609654 TCGCCTGGGCGTTCCGGGAGCGG No data
922832178_922832185 -3 Left 922832178 1:228609580-228609602 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922832185 1:228609600-228609622 GTGCGACGACGGCGCCCGATGGG No data
922832178_922832188 14 Left 922832178 1:228609580-228609602 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922832188 1:228609617-228609639 GATGGGTGAATTGAATCGCCTGG No data
922832178_922832189 15 Left 922832178 1:228609580-228609602 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922832189 1:228609618-228609640 ATGGGTGAATTGAATCGCCTGGG No data
922832178_922832190 23 Left 922832178 1:228609580-228609602 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922832190 1:228609626-228609648 ATTGAATCGCCTGGGCGTTCCGG No data
922832178_922832191 24 Left 922832178 1:228609580-228609602 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922832191 1:228609627-228609649 TTGAATCGCCTGGGCGTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922832178 Original CRISPR CACCCTTCCAAACCGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr