ID: 922832682

View in Genome Browser
Species Human (GRCh38)
Location 1:228611613-228611635
Sequence CCGGGCGGGCCCGGAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922832668_922832682 4 Left 922832668 1:228611586-228611608 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922832682 1:228611613-228611635 CCGGGCGGGCCCGGAGGCCTGGG No data
922832664_922832682 23 Left 922832664 1:228611567-228611589 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922832682 1:228611613-228611635 CCGGGCGGGCCCGGAGGCCTGGG No data
922832669_922832682 3 Left 922832669 1:228611587-228611609 CCGCCCGTTTGGCGGGAGCCGTG No data
Right 922832682 1:228611613-228611635 CCGGGCGGGCCCGGAGGCCTGGG No data
922832662_922832682 25 Left 922832662 1:228611565-228611587 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922832682 1:228611613-228611635 CCGGGCGGGCCCGGAGGCCTGGG No data
922832671_922832682 0 Left 922832671 1:228611590-228611612 CCCGTTTGGCGGGAGCCGTGGCA No data
Right 922832682 1:228611613-228611635 CCGGGCGGGCCCGGAGGCCTGGG No data
922832663_922832682 24 Left 922832663 1:228611566-228611588 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922832682 1:228611613-228611635 CCGGGCGGGCCCGGAGGCCTGGG No data
922832672_922832682 -1 Left 922832672 1:228611591-228611613 CCGTTTGGCGGGAGCCGTGGCAC No data
Right 922832682 1:228611613-228611635 CCGGGCGGGCCCGGAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922832682 Original CRISPR CCGGGCGGGCCCGGAGGCCT GGG Intergenic
No off target data available for this crispr