ID: 922832738

View in Genome Browser
Species Human (GRCh38)
Location 1:228611821-228611843
Sequence CACCCTTCCAAACCGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922832738_922832753 30 Left 922832738 1:228611821-228611843 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922832753 1:228611874-228611896 CGCCTGGGCGTTCCGGGAGCGGG No data
922832738_922832749 15 Left 922832738 1:228611821-228611843 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922832749 1:228611859-228611881 ATGGGTGAATTGAATCGCCTGGG No data
922832738_922832748 14 Left 922832738 1:228611821-228611843 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922832748 1:228611858-228611880 GATGGGTGAATTGAATCGCCTGG No data
922832738_922832750 23 Left 922832738 1:228611821-228611843 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922832750 1:228611867-228611889 ATTGAATCGCCTGGGCGTTCCGG No data
922832738_922832752 29 Left 922832738 1:228611821-228611843 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922832752 1:228611873-228611895 TCGCCTGGGCGTTCCGGGAGCGG No data
922832738_922832751 24 Left 922832738 1:228611821-228611843 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922832751 1:228611868-228611890 TTGAATCGCCTGGGCGTTCCGGG No data
922832738_922832744 -4 Left 922832738 1:228611821-228611843 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922832744 1:228611840-228611862 GGTGCGACGACGGCGCCCGATGG No data
922832738_922832745 -3 Left 922832738 1:228611821-228611843 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922832745 1:228611841-228611863 GTGCGACGACGGCGCCCGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922832738 Original CRISPR CACCCTTCCAAACCGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr