ID: 922833243

View in Genome Browser
Species Human (GRCh38)
Location 1:228613854-228613876
Sequence CCGGGCGGGCCCGGAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922833230_922833243 3 Left 922833230 1:228613828-228613850 CCGCCCGTTTGGCGGGAGCCGTG No data
Right 922833243 1:228613854-228613876 CCGGGCGGGCCCGGAGGCCTGGG No data
922833223_922833243 25 Left 922833223 1:228613806-228613828 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922833243 1:228613854-228613876 CCGGGCGGGCCCGGAGGCCTGGG No data
922833225_922833243 23 Left 922833225 1:228613808-228613830 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922833243 1:228613854-228613876 CCGGGCGGGCCCGGAGGCCTGGG No data
922833224_922833243 24 Left 922833224 1:228613807-228613829 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922833243 1:228613854-228613876 CCGGGCGGGCCCGGAGGCCTGGG No data
922833232_922833243 0 Left 922833232 1:228613831-228613853 CCCGTTTGGCGGGAGCCGTGGCA No data
Right 922833243 1:228613854-228613876 CCGGGCGGGCCCGGAGGCCTGGG No data
922833233_922833243 -1 Left 922833233 1:228613832-228613854 CCGTTTGGCGGGAGCCGTGGCAC No data
Right 922833243 1:228613854-228613876 CCGGGCGGGCCCGGAGGCCTGGG No data
922833229_922833243 4 Left 922833229 1:228613827-228613849 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922833243 1:228613854-228613876 CCGGGCGGGCCCGGAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922833243 Original CRISPR CCGGGCGGGCCCGGAGGCCT GGG Intergenic
No off target data available for this crispr