ID: 922833299

View in Genome Browser
Species Human (GRCh38)
Location 1:228614062-228614084
Sequence CACCCTTCCAAACCGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922833299_922833311 23 Left 922833299 1:228614062-228614084 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922833311 1:228614108-228614130 ATTGAATCGCCTGGGCGTTCCGG No data
922833299_922833313 29 Left 922833299 1:228614062-228614084 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922833313 1:228614114-228614136 TCGCCTGGGCGTTCCGGGAGCGG No data
922833299_922833305 -4 Left 922833299 1:228614062-228614084 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922833305 1:228614081-228614103 GGTGCGACGACGGCGCCCGATGG No data
922833299_922833306 -3 Left 922833299 1:228614062-228614084 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922833306 1:228614082-228614104 GTGCGACGACGGCGCCCGATGGG No data
922833299_922833314 30 Left 922833299 1:228614062-228614084 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922833314 1:228614115-228614137 CGCCTGGGCGTTCCGGGAGCGGG No data
922833299_922833312 24 Left 922833299 1:228614062-228614084 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922833312 1:228614109-228614131 TTGAATCGCCTGGGCGTTCCGGG No data
922833299_922833309 14 Left 922833299 1:228614062-228614084 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922833309 1:228614099-228614121 GATGGGTGAATTGAATCGCCTGG No data
922833299_922833310 15 Left 922833299 1:228614062-228614084 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922833310 1:228614100-228614122 ATGGGTGAATTGAATCGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922833299 Original CRISPR CACCCTTCCAAACCGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr