ID: 922833803

View in Genome Browser
Species Human (GRCh38)
Location 1:228616095-228616117
Sequence CCGGGCGGGCCCGGAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922833784_922833803 24 Left 922833784 1:228616048-228616070 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922833803 1:228616095-228616117 CCGGGCGGGCCCGGAGGCCTGGG No data
922833793_922833803 -1 Left 922833793 1:228616073-228616095 CCGTTTGGCGGGAGCCGTGGCAC No data
Right 922833803 1:228616095-228616117 CCGGGCGGGCCCGGAGGCCTGGG No data
922833785_922833803 23 Left 922833785 1:228616049-228616071 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922833803 1:228616095-228616117 CCGGGCGGGCCCGGAGGCCTGGG No data
922833783_922833803 25 Left 922833783 1:228616047-228616069 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922833803 1:228616095-228616117 CCGGGCGGGCCCGGAGGCCTGGG No data
922833790_922833803 3 Left 922833790 1:228616069-228616091 CCGCCCGTTTGGCGGGAGCCGTG No data
Right 922833803 1:228616095-228616117 CCGGGCGGGCCCGGAGGCCTGGG No data
922833792_922833803 0 Left 922833792 1:228616072-228616094 CCCGTTTGGCGGGAGCCGTGGCA No data
Right 922833803 1:228616095-228616117 CCGGGCGGGCCCGGAGGCCTGGG No data
922833789_922833803 4 Left 922833789 1:228616068-228616090 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922833803 1:228616095-228616117 CCGGGCGGGCCCGGAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922833803 Original CRISPR CCGGGCGGGCCCGGAGGCCT GGG Intergenic
No off target data available for this crispr