ID: 922833859

View in Genome Browser
Species Human (GRCh38)
Location 1:228616303-228616325
Sequence CACCCTTCCAAACCGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922833859_922833866 -3 Left 922833859 1:228616303-228616325 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922833866 1:228616323-228616345 GTGCGACGACGGCGCCCGATGGG No data
922833859_922833872 24 Left 922833859 1:228616303-228616325 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922833872 1:228616350-228616372 TTGAATCGCCTGGGCGTTCCGGG No data
922833859_922833874 30 Left 922833859 1:228616303-228616325 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922833874 1:228616356-228616378 CGCCTGGGCGTTCCGGGAGCGGG No data
922833859_922833873 29 Left 922833859 1:228616303-228616325 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922833873 1:228616355-228616377 TCGCCTGGGCGTTCCGGGAGCGG No data
922833859_922833870 15 Left 922833859 1:228616303-228616325 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922833870 1:228616341-228616363 ATGGGTGAATTGAATCGCCTGGG No data
922833859_922833865 -4 Left 922833859 1:228616303-228616325 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922833865 1:228616322-228616344 GGTGCGACGACGGCGCCCGATGG No data
922833859_922833869 14 Left 922833859 1:228616303-228616325 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922833869 1:228616340-228616362 GATGGGTGAATTGAATCGCCTGG No data
922833859_922833871 23 Left 922833859 1:228616303-228616325 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922833871 1:228616349-228616371 ATTGAATCGCCTGGGCGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922833859 Original CRISPR CACCCTTCCAAACCGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr