ID: 922834360

View in Genome Browser
Species Human (GRCh38)
Location 1:228618336-228618358
Sequence CCGGGCGGGCCCGGAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922834349_922834360 0 Left 922834349 1:228618313-228618335 CCCGTTTGGCGGGAGCCGTGGCA No data
Right 922834360 1:228618336-228618358 CCGGGCGGGCCCGGAGGCCTGGG No data
922834341_922834360 24 Left 922834341 1:228618289-228618311 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922834360 1:228618336-228618358 CCGGGCGGGCCCGGAGGCCTGGG No data
922834346_922834360 4 Left 922834346 1:228618309-228618331 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922834360 1:228618336-228618358 CCGGGCGGGCCCGGAGGCCTGGG No data
922834340_922834360 25 Left 922834340 1:228618288-228618310 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922834360 1:228618336-228618358 CCGGGCGGGCCCGGAGGCCTGGG No data
922834342_922834360 23 Left 922834342 1:228618290-228618312 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922834360 1:228618336-228618358 CCGGGCGGGCCCGGAGGCCTGGG No data
922834347_922834360 3 Left 922834347 1:228618310-228618332 CCGCCCGTTTGGCGGGAGCCGTG No data
Right 922834360 1:228618336-228618358 CCGGGCGGGCCCGGAGGCCTGGG No data
922834350_922834360 -1 Left 922834350 1:228618314-228618336 CCGTTTGGCGGGAGCCGTGGCAC No data
Right 922834360 1:228618336-228618358 CCGGGCGGGCCCGGAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922834360 Original CRISPR CCGGGCGGGCCCGGAGGCCT GGG Intergenic
No off target data available for this crispr