ID: 922834416

View in Genome Browser
Species Human (GRCh38)
Location 1:228618544-228618566
Sequence CACCCTTCCAAACCGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922834416_922834428 23 Left 922834416 1:228618544-228618566 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922834428 1:228618590-228618612 ATTGAATCGCCTGGGCGTTCCGG No data
922834416_922834426 14 Left 922834416 1:228618544-228618566 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922834426 1:228618581-228618603 GATGGGTGAATTGAATCGCCTGG No data
922834416_922834429 24 Left 922834416 1:228618544-228618566 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922834429 1:228618591-228618613 TTGAATCGCCTGGGCGTTCCGGG No data
922834416_922834430 29 Left 922834416 1:228618544-228618566 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922834430 1:228618596-228618618 TCGCCTGGGCGTTCCGGGAGCGG No data
922834416_922834427 15 Left 922834416 1:228618544-228618566 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922834427 1:228618582-228618604 ATGGGTGAATTGAATCGCCTGGG No data
922834416_922834423 -3 Left 922834416 1:228618544-228618566 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922834423 1:228618564-228618586 GTGCGACGACGGCGCCCGATGGG No data
922834416_922834422 -4 Left 922834416 1:228618544-228618566 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922834422 1:228618563-228618585 GGTGCGACGACGGCGCCCGATGG No data
922834416_922834431 30 Left 922834416 1:228618544-228618566 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922834431 1:228618597-228618619 CGCCTGGGCGTTCCGGGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922834416 Original CRISPR CACCCTTCCAAACCGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr