ID: 922834895

View in Genome Browser
Species Human (GRCh38)
Location 1:228620488-228620510
Sequence AAGGCACCCAGAGCACAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922834895_922834907 23 Left 922834895 1:228620488-228620510 CCTCCCTGTGCTCTGGGTGCCTT No data
Right 922834907 1:228620534-228620556 AGCGCGCCCGCCCGTTTGGCGGG No data
922834895_922834906 22 Left 922834895 1:228620488-228620510 CCTCCCTGTGCTCTGGGTGCCTT No data
Right 922834906 1:228620533-228620555 GAGCGCGCCCGCCCGTTTGGCGG No data
922834895_922834905 19 Left 922834895 1:228620488-228620510 CCTCCCTGTGCTCTGGGTGCCTT No data
Right 922834905 1:228620530-228620552 GCAGAGCGCGCCCGCCCGTTTGG 0: 18
1: 0
2: 2
3: 2
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922834895 Original CRISPR AAGGCACCCAGAGCACAGGG AGG (reversed) Intergenic