ID: 922834896

View in Genome Browser
Species Human (GRCh38)
Location 1:228620491-228620513
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922834896_922834905 16 Left 922834896 1:228620491-228620513 CCCTGTGCTCTGGGTGCCTTGCG No data
Right 922834905 1:228620530-228620552 GCAGAGCGCGCCCGCCCGTTTGG 0: 18
1: 0
2: 2
3: 2
4: 35
922834896_922834907 20 Left 922834896 1:228620491-228620513 CCCTGTGCTCTGGGTGCCTTGCG No data
Right 922834907 1:228620534-228620556 AGCGCGCCCGCCCGTTTGGCGGG No data
922834896_922834906 19 Left 922834896 1:228620491-228620513 CCCTGTGCTCTGGGTGCCTTGCG No data
Right 922834906 1:228620533-228620555 GAGCGCGCCCGCCCGTTTGGCGG No data
922834896_922834910 28 Left 922834896 1:228620491-228620513 CCCTGTGCTCTGGGTGCCTTGCG No data
Right 922834910 1:228620542-228620564 CGCCCGTTTGGCGGGAGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922834896 Original CRISPR CGCAAGGCACCCAGAGCACA GGG (reversed) Intergenic