ID: 922834901

View in Genome Browser
Species Human (GRCh38)
Location 1:228620507-228620529
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922834901_922834917 28 Left 922834901 1:228620507-228620529 CCTTGCGGCGGGCCCCGAGATTT No data
Right 922834917 1:228620558-228620580 GCCGTGGCACCGGGCGGGCCCGG No data
922834901_922834913 18 Left 922834901 1:228620507-228620529 CCTTGCGGCGGGCCCCGAGATTT No data
Right 922834913 1:228620548-228620570 TTTGGCGGGAGCCGTGGCACCGG No data
922834901_922834915 22 Left 922834901 1:228620507-228620529 CCTTGCGGCGGGCCCCGAGATTT No data
Right 922834915 1:228620552-228620574 GCGGGAGCCGTGGCACCGGGCGG No data
922834901_922834906 3 Left 922834901 1:228620507-228620529 CCTTGCGGCGGGCCCCGAGATTT No data
Right 922834906 1:228620533-228620555 GAGCGCGCCCGCCCGTTTGGCGG No data
922834901_922834910 12 Left 922834901 1:228620507-228620529 CCTTGCGGCGGGCCCCGAGATTT No data
Right 922834910 1:228620542-228620564 CGCCCGTTTGGCGGGAGCCGTGG No data
922834901_922834916 23 Left 922834901 1:228620507-228620529 CCTTGCGGCGGGCCCCGAGATTT No data
Right 922834916 1:228620553-228620575 CGGGAGCCGTGGCACCGGGCGGG No data
922834901_922834905 0 Left 922834901 1:228620507-228620529 CCTTGCGGCGGGCCCCGAGATTT No data
Right 922834905 1:228620530-228620552 GCAGAGCGCGCCCGCCCGTTTGG No data
922834901_922834907 4 Left 922834901 1:228620507-228620529 CCTTGCGGCGGGCCCCGAGATTT No data
Right 922834907 1:228620534-228620556 AGCGCGCCCGCCCGTTTGGCGGG No data
922834901_922834914 19 Left 922834901 1:228620507-228620529 CCTTGCGGCGGGCCCCGAGATTT No data
Right 922834914 1:228620549-228620571 TTGGCGGGAGCCGTGGCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922834901 Original CRISPR AAATCTCGGGGCCCGCCGCA AGG (reversed) Intergenic