ID: 922834902

View in Genome Browser
Species Human (GRCh38)
Location 1:228620519-228620541
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922834902_922834906 -9 Left 922834902 1:228620519-228620541 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922834906 1:228620533-228620555 GAGCGCGCCCGCCCGTTTGGCGG No data
922834902_922834907 -8 Left 922834902 1:228620519-228620541 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922834907 1:228620534-228620556 AGCGCGCCCGCCCGTTTGGCGGG No data
922834902_922834922 25 Left 922834902 1:228620519-228620541 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922834922 1:228620567-228620589 CCGGGCGGGCCCGGAGGCCTGGG No data
922834902_922834919 19 Left 922834902 1:228620519-228620541 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922834919 1:228620561-228620583 GTGGCACCGGGCGGGCCCGGAGG No data
922834902_922834920 24 Left 922834902 1:228620519-228620541 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922834920 1:228620566-228620588 ACCGGGCGGGCCCGGAGGCCTGG No data
922834902_922834914 7 Left 922834902 1:228620519-228620541 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922834914 1:228620549-228620571 TTGGCGGGAGCCGTGGCACCGGG No data
922834902_922834913 6 Left 922834902 1:228620519-228620541 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922834913 1:228620548-228620570 TTTGGCGGGAGCCGTGGCACCGG No data
922834902_922834915 10 Left 922834902 1:228620519-228620541 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922834915 1:228620552-228620574 GCGGGAGCCGTGGCACCGGGCGG No data
922834902_922834916 11 Left 922834902 1:228620519-228620541 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922834916 1:228620553-228620575 CGGGAGCCGTGGCACCGGGCGGG No data
922834902_922834917 16 Left 922834902 1:228620519-228620541 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922834917 1:228620558-228620580 GCCGTGGCACCGGGCGGGCCCGG No data
922834902_922834910 0 Left 922834902 1:228620519-228620541 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922834910 1:228620542-228620564 CGCCCGTTTGGCGGGAGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922834902 Original CRISPR GGCGCGCTCTGCAAATCTCG GGG (reversed) Intergenic
No off target data available for this crispr