ID: 922834903

View in Genome Browser
Species Human (GRCh38)
Location 1:228620520-228620542
Sequence GGGCGCGCTCTGCAAATCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922834903_922834917 15 Left 922834903 1:228620520-228620542 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922834917 1:228620558-228620580 GCCGTGGCACCGGGCGGGCCCGG No data
922834903_922834915 9 Left 922834903 1:228620520-228620542 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922834915 1:228620552-228620574 GCGGGAGCCGTGGCACCGGGCGG No data
922834903_922834914 6 Left 922834903 1:228620520-228620542 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922834914 1:228620549-228620571 TTGGCGGGAGCCGTGGCACCGGG No data
922834903_922834913 5 Left 922834903 1:228620520-228620542 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922834913 1:228620548-228620570 TTTGGCGGGAGCCGTGGCACCGG No data
922834903_922834907 -9 Left 922834903 1:228620520-228620542 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922834907 1:228620534-228620556 AGCGCGCCCGCCCGTTTGGCGGG No data
922834903_922834906 -10 Left 922834903 1:228620520-228620542 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922834906 1:228620533-228620555 GAGCGCGCCCGCCCGTTTGGCGG No data
922834903_922834920 23 Left 922834903 1:228620520-228620542 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922834920 1:228620566-228620588 ACCGGGCGGGCCCGGAGGCCTGG No data
922834903_922834910 -1 Left 922834903 1:228620520-228620542 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922834910 1:228620542-228620564 CGCCCGTTTGGCGGGAGCCGTGG No data
922834903_922834919 18 Left 922834903 1:228620520-228620542 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922834919 1:228620561-228620583 GTGGCACCGGGCGGGCCCGGAGG No data
922834903_922834922 24 Left 922834903 1:228620520-228620542 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922834922 1:228620567-228620589 CCGGGCGGGCCCGGAGGCCTGGG No data
922834903_922834916 10 Left 922834903 1:228620520-228620542 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922834916 1:228620553-228620575 CGGGAGCCGTGGCACCGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922834903 Original CRISPR GGGCGCGCTCTGCAAATCTC GGG (reversed) Intergenic