ID: 922834904

View in Genome Browser
Species Human (GRCh38)
Location 1:228620521-228620543
Sequence CGGGCGCGCTCTGCAAATCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922834904_922834917 14 Left 922834904 1:228620521-228620543 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922834917 1:228620558-228620580 GCCGTGGCACCGGGCGGGCCCGG No data
922834904_922834913 4 Left 922834904 1:228620521-228620543 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922834913 1:228620548-228620570 TTTGGCGGGAGCCGTGGCACCGG No data
922834904_922834922 23 Left 922834904 1:228620521-228620543 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922834922 1:228620567-228620589 CCGGGCGGGCCCGGAGGCCTGGG No data
922834904_922834916 9 Left 922834904 1:228620521-228620543 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922834916 1:228620553-228620575 CGGGAGCCGTGGCACCGGGCGGG No data
922834904_922834923 30 Left 922834904 1:228620521-228620543 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922834923 1:228620574-228620596 GGCCCGGAGGCCTGGGTCTCTGG No data
922834904_922834910 -2 Left 922834904 1:228620521-228620543 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922834910 1:228620542-228620564 CGCCCGTTTGGCGGGAGCCGTGG No data
922834904_922834914 5 Left 922834904 1:228620521-228620543 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922834914 1:228620549-228620571 TTGGCGGGAGCCGTGGCACCGGG No data
922834904_922834915 8 Left 922834904 1:228620521-228620543 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922834915 1:228620552-228620574 GCGGGAGCCGTGGCACCGGGCGG No data
922834904_922834907 -10 Left 922834904 1:228620521-228620543 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922834907 1:228620534-228620556 AGCGCGCCCGCCCGTTTGGCGGG No data
922834904_922834919 17 Left 922834904 1:228620521-228620543 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922834919 1:228620561-228620583 GTGGCACCGGGCGGGCCCGGAGG No data
922834904_922834920 22 Left 922834904 1:228620521-228620543 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922834920 1:228620566-228620588 ACCGGGCGGGCCCGGAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922834904 Original CRISPR CGGGCGCGCTCTGCAAATCT CGG (reversed) Intergenic
No off target data available for this crispr