ID: 922834905

View in Genome Browser
Species Human (GRCh38)
Location 1:228620530-228620552
Sequence GCAGAGCGCGCCCGCCCGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922834901_922834905 0 Left 922834901 1:228620507-228620529 CCTTGCGGCGGGCCCCGAGATTT No data
Right 922834905 1:228620530-228620552 GCAGAGCGCGCCCGCCCGTTTGG No data
922834897_922834905 15 Left 922834897 1:228620492-228620514 CCTGTGCTCTGGGTGCCTTGCGG No data
Right 922834905 1:228620530-228620552 GCAGAGCGCGCCCGCCCGTTTGG No data
922834895_922834905 19 Left 922834895 1:228620488-228620510 CCTCCCTGTGCTCTGGGTGCCTT No data
Right 922834905 1:228620530-228620552 GCAGAGCGCGCCCGCCCGTTTGG No data
922834896_922834905 16 Left 922834896 1:228620491-228620513 CCCTGTGCTCTGGGTGCCTTGCG No data
Right 922834905 1:228620530-228620552 GCAGAGCGCGCCCGCCCGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922834905 Original CRISPR GCAGAGCGCGCCCGCCCGTT TGG Intergenic