ID: 922834906

View in Genome Browser
Species Human (GRCh38)
Location 1:228620533-228620555
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922834896_922834906 19 Left 922834896 1:228620491-228620513 CCCTGTGCTCTGGGTGCCTTGCG No data
Right 922834906 1:228620533-228620555 GAGCGCGCCCGCCCGTTTGGCGG No data
922834903_922834906 -10 Left 922834903 1:228620520-228620542 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922834906 1:228620533-228620555 GAGCGCGCCCGCCCGTTTGGCGG No data
922834901_922834906 3 Left 922834901 1:228620507-228620529 CCTTGCGGCGGGCCCCGAGATTT No data
Right 922834906 1:228620533-228620555 GAGCGCGCCCGCCCGTTTGGCGG No data
922834902_922834906 -9 Left 922834902 1:228620519-228620541 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922834906 1:228620533-228620555 GAGCGCGCCCGCCCGTTTGGCGG No data
922834897_922834906 18 Left 922834897 1:228620492-228620514 CCTGTGCTCTGGGTGCCTTGCGG No data
Right 922834906 1:228620533-228620555 GAGCGCGCCCGCCCGTTTGGCGG No data
922834895_922834906 22 Left 922834895 1:228620488-228620510 CCTCCCTGTGCTCTGGGTGCCTT No data
Right 922834906 1:228620533-228620555 GAGCGCGCCCGCCCGTTTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr