ID: 922834908

View in Genome Browser
Species Human (GRCh38)
Location 1:228620540-228620562
Sequence ACGGCTCCCGCCAAACGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922834908_922834919 -2 Left 922834908 1:228620540-228620562 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922834919 1:228620561-228620583 GTGGCACCGGGCGGGCCCGGAGG No data
922834908_922834916 -10 Left 922834908 1:228620540-228620562 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922834916 1:228620553-228620575 CGGGAGCCGTGGCACCGGGCGGG No data
922834908_922834928 23 Left 922834908 1:228620540-228620562 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922834928 1:228620586-228620608 TGGGTCTCTGGCGAGTCCTCGGG No data
922834908_922834929 28 Left 922834908 1:228620540-228620562 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922834929 1:228620591-228620613 CTCTGGCGAGTCCTCGGGACTGG No data
922834908_922834917 -5 Left 922834908 1:228620540-228620562 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922834917 1:228620558-228620580 GCCGTGGCACCGGGCGGGCCCGG No data
922834908_922834920 3 Left 922834908 1:228620540-228620562 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922834920 1:228620566-228620588 ACCGGGCGGGCCCGGAGGCCTGG No data
922834908_922834923 11 Left 922834908 1:228620540-228620562 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922834923 1:228620574-228620596 GGCCCGGAGGCCTGGGTCTCTGG No data
922834908_922834922 4 Left 922834908 1:228620540-228620562 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922834922 1:228620567-228620589 CCGGGCGGGCCCGGAGGCCTGGG No data
922834908_922834927 22 Left 922834908 1:228620540-228620562 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922834927 1:228620585-228620607 CTGGGTCTCTGGCGAGTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922834908 Original CRISPR ACGGCTCCCGCCAAACGGGC GGG (reversed) Intergenic