ID: 922834910

View in Genome Browser
Species Human (GRCh38)
Location 1:228620542-228620564
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922834896_922834910 28 Left 922834896 1:228620491-228620513 CCCTGTGCTCTGGGTGCCTTGCG No data
Right 922834910 1:228620542-228620564 CGCCCGTTTGGCGGGAGCCGTGG No data
922834901_922834910 12 Left 922834901 1:228620507-228620529 CCTTGCGGCGGGCCCCGAGATTT No data
Right 922834910 1:228620542-228620564 CGCCCGTTTGGCGGGAGCCGTGG No data
922834903_922834910 -1 Left 922834903 1:228620520-228620542 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922834910 1:228620542-228620564 CGCCCGTTTGGCGGGAGCCGTGG No data
922834902_922834910 0 Left 922834902 1:228620519-228620541 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922834910 1:228620542-228620564 CGCCCGTTTGGCGGGAGCCGTGG No data
922834904_922834910 -2 Left 922834904 1:228620521-228620543 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922834910 1:228620542-228620564 CGCCCGTTTGGCGGGAGCCGTGG No data
922834897_922834910 27 Left 922834897 1:228620492-228620514 CCTGTGCTCTGGGTGCCTTGCGG No data
Right 922834910 1:228620542-228620564 CGCCCGTTTGGCGGGAGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type