ID: 922834912

View in Genome Browser
Species Human (GRCh38)
Location 1:228620545-228620567
Sequence GTGCCACGGCTCCCGCCAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922834912_922834929 23 Left 922834912 1:228620545-228620567 CCGTTTGGCGGGAGCCGTGGCAC No data
Right 922834929 1:228620591-228620613 CTCTGGCGAGTCCTCGGGACTGG No data
922834912_922834927 17 Left 922834912 1:228620545-228620567 CCGTTTGGCGGGAGCCGTGGCAC No data
Right 922834927 1:228620585-228620607 CTGGGTCTCTGGCGAGTCCTCGG No data
922834912_922834928 18 Left 922834912 1:228620545-228620567 CCGTTTGGCGGGAGCCGTGGCAC No data
Right 922834928 1:228620586-228620608 TGGGTCTCTGGCGAGTCCTCGGG No data
922834912_922834919 -7 Left 922834912 1:228620545-228620567 CCGTTTGGCGGGAGCCGTGGCAC No data
Right 922834919 1:228620561-228620583 GTGGCACCGGGCGGGCCCGGAGG No data
922834912_922834923 6 Left 922834912 1:228620545-228620567 CCGTTTGGCGGGAGCCGTGGCAC No data
Right 922834923 1:228620574-228620596 GGCCCGGAGGCCTGGGTCTCTGG No data
922834912_922834917 -10 Left 922834912 1:228620545-228620567 CCGTTTGGCGGGAGCCGTGGCAC No data
Right 922834917 1:228620558-228620580 GCCGTGGCACCGGGCGGGCCCGG No data
922834912_922834922 -1 Left 922834912 1:228620545-228620567 CCGTTTGGCGGGAGCCGTGGCAC No data
Right 922834922 1:228620567-228620589 CCGGGCGGGCCCGGAGGCCTGGG No data
922834912_922834920 -2 Left 922834912 1:228620545-228620567 CCGTTTGGCGGGAGCCGTGGCAC No data
Right 922834920 1:228620566-228620588 ACCGGGCGGGCCCGGAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922834912 Original CRISPR GTGCCACGGCTCCCGCCAAA CGG (reversed) Intergenic
No off target data available for this crispr