ID: 922834914

View in Genome Browser
Species Human (GRCh38)
Location 1:228620549-228620571
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922834904_922834914 5 Left 922834904 1:228620521-228620543 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922834914 1:228620549-228620571 TTGGCGGGAGCCGTGGCACCGGG No data
922834901_922834914 19 Left 922834901 1:228620507-228620529 CCTTGCGGCGGGCCCCGAGATTT No data
Right 922834914 1:228620549-228620571 TTGGCGGGAGCCGTGGCACCGGG No data
922834902_922834914 7 Left 922834902 1:228620519-228620541 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922834914 1:228620549-228620571 TTGGCGGGAGCCGTGGCACCGGG No data
922834903_922834914 6 Left 922834903 1:228620520-228620542 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922834914 1:228620549-228620571 TTGGCGGGAGCCGTGGCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type