ID: 922834916

View in Genome Browser
Species Human (GRCh38)
Location 1:228620553-228620575
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922834904_922834916 9 Left 922834904 1:228620521-228620543 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922834916 1:228620553-228620575 CGGGAGCCGTGGCACCGGGCGGG No data
922834901_922834916 23 Left 922834901 1:228620507-228620529 CCTTGCGGCGGGCCCCGAGATTT No data
Right 922834916 1:228620553-228620575 CGGGAGCCGTGGCACCGGGCGGG No data
922834903_922834916 10 Left 922834903 1:228620520-228620542 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922834916 1:228620553-228620575 CGGGAGCCGTGGCACCGGGCGGG No data
922834902_922834916 11 Left 922834902 1:228620519-228620541 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922834916 1:228620553-228620575 CGGGAGCCGTGGCACCGGGCGGG No data
922834908_922834916 -10 Left 922834908 1:228620540-228620562 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922834916 1:228620553-228620575 CGGGAGCCGTGGCACCGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type